| Author |
Message |
    
guess (Srqmale)
New member
Username: Srqmale
Post Number: 1
Registered: 3-2006
| | Posted on Wednesday, March 15, 2006 - 7:03 pm: |       |
Where can I find a one megahertz oscillator? I noticed a ferrite core coil and variable capacitor on a old Am radio that I have. But not a megahertz oscillator. |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1114
Registered: 12-2004
| | Posted on Wednesday, March 15, 2006 - 7:29 pm: | |
We offer them in our catalog. |
moisdaniel (Pinky)
Junior Member
Username: Pinky
Post Number: 9
Registered: 7-2005
| | Posted on Friday, April 28, 2006 - 12:12 pm: | |
Hi! I first want to congratulate you for this amaizing site. It's full of very useful stuff. I thank you for helping us through this forum wich is like a huge library!
I am part of a small school theatre team and we have a play in wich we are in hell, ane I was wondering if you could help us with some ideeas in creating some sort of smoke. I was thinking of the scarry mouvies I seen in wich there was a havy wite very dens on the graound without rising in the air. I don't know that is possible for us, but that was my inspiration.
Thnak you for everithing you are doing for us! (sorry for my grammar) |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1184
Registered: 12-2004
| | Posted on Friday, April 28, 2006 - 1:14 pm: | |
See these sites:
"http://chemistry.about.com/library/weekly/aa010603a.htm"
"http://chemistry.about.com/library/weekly/aa010603b.htm"
"http://chemistry.about.com/library/weekly/aa010603c.htm"
"http://www.samash.com/catalog/showitem.asp?SKU=EEF400XXX"
"http://www.coolstuffcheap.com/fx-800.html"
...and work on that grammar ;-)
The Google Toolbar has a great spell checker for web postings
like this one. |
moisdaniel (Pinky)
Junior Member
Username: Pinky
Post Number: 10
Registered: 7-2005
| | Posted on Saturday, April 29, 2006 - 11:12 am: | |
Thank for your quick answer!
The links are very ysefull!
But unfortunetly, I have no idee where to get dry ice or liquid nitrogen from!
From what I read in the articles dry ice is solid corbon dioxide and I don't think I will find it in my town for sell!
Thanks again for your help! |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1188
Registered: 12-2004
| | Posted on Saturday, April 29, 2006 - 9:20 pm: | |
Both are pretty easy to get where I live (Silicon Valley).
Look in your phone directory. |
moisdaniel (Pinky)
Member
Username: Pinky
Post Number: 11
Registered: 7-2005
| | Posted on Sunday, April 30, 2006 - 4:55 am: | |
I searched on Goolge and I found a supplier for Dryice but I don't know haw much to buy
I want to have a 20 cm high sheeat of fog on a area of 10m X 6m.
I was thinking to build the fog machine myself as I found some easy plans as I understood the proces.
I thank you for all your help!
I hope I will be able to pull someting out of my creazy ideeas! |
rishi kohli (Rishi12)
New member
Username: Rishi12
Post Number: 1
Registered: 5-2006
| | Posted on Thursday, May 25, 2006 - 3:24 am: | |
does anyone has an idea about the following:
1: an IR rays reciever detects infrared rays coming from a IR transmitter. the recievr has a transistor attached to it which then has a current flowing thru it after IR rays are detected.
now i want to use this current to produce fire . i was thinking of using the concept of an electric lighter but not quite sure how it works.
anyone has an idea? |
Antariksh Bothale (Antariksh)
New member
Username: Antariksh
Post Number: 1
Registered: 5-2006
| | Posted on Tuesday, May 30, 2006 - 9:09 pm: | |
Hello. First of all, I would like to congratulate you for this wonderful site, scitoys.
I made the laser communicator recently and it works out fine.
However, I have three questions:
1. I currently use a very cheap laser pointer (which is more or less a toy) which I bought
for Indian Rupees 20 (<50 cents). The laser spot is quite blurred at the edges and is quite
big in diameter. I have bought two of the them and have managed to spoil both. Both now emit
a very dim light which is of no use. How can I have sure-shot protection against it? Before
I invest in some expensive LASER pointer, I want to know the bearing of the laser's
intensity, size, colour etc. on the reception and it's quality, and also, methods to protect
tle laser.
2. I am finding it hard to get the Audio Output Transformer. I wanted to know if there is
any alternative circuitry which I can substitute for the Transformer, something that will do
the same job.
3. Also, I intend to submit this as a project which students of class XII need to submit for
their Board Examinations (~ GCA 'A' level). Though it is an interesting project,
unfortunately, it doesn't [i]apparantly[/i] require much effort (I know it does require
effort, but it will be hard to get the fact across to the examiner). I wanted to know if I
could extend the project on the same line. For eg. can I use it to transfer data between two
computers? (I saw your Morse Code Transmitter. But I wanted some circuit by which I can
receive via the serial port of the other computer rather than the audio jack). That is,
using Laser as the communication medium, can I perform something which will be even more
dazzling, if not practicable?
P.S. I added it here because I could not find the Add New Conversation button. |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1245
Registered: 12-2004
| | Posted on Wednesday, May 31, 2006 - 10:00 am: | |
The bicolor LED will protect the laser.
We offer the audio output transformer in our catalog. You could design
a transistor circuit to do the modulation, but the transformer is much
simpler and has much less that can go wrong.
You can make the project more difficult if you like, but I try to do
the exact opposite in my books. You can build two simple telescopes
using fresnel page magnifiers, and use one at the transmitting end and
the other at the receiver, to see how far you can make the signal go.
I would bet that a few miles would be impressive enough. |
Stojance (Stojance)
Advanced Member
Username: Stojance
Post Number: 63
Registered: 4-2006
| | Posted on Thursday, June 1, 2006 - 8:01 am: | |
Is it possible to write a program in asm and then copy it in my MP3 player and it would do the things that the program said? Because it is an EEPROM (or similar). |
Richard OBrien (Richard)
New member
Username: Richard
Post Number: 2
Registered: 6-2006
| | Posted on Saturday, June 3, 2006 - 8:43 am: | |
Does any1 know how to make pop pops with easy to find ingrediants? |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1251
Registered: 12-2004
| | Posted on Saturday, June 3, 2006 - 9:15 pm: | |
See "http://sci-toys.com/scitoys/scitoys/thermo/thermo.html#boat". |
rishi kohli (Rishibond)
New member
Username: Rishibond
Post Number: 1
Registered: 6-2006
| | Posted on Monday, June 12, 2006 - 9:53 pm: | |
does any one has a circuit to build a simpple RF transmitter and a RF reciever.
the ones i came across has encoder and decoders in them. but my trasmitter is fairly simple with jus one button to send a signal .
ny ideas. |
Stojance (Stojance)
Advanced Member
Username: Stojance
Post Number: 73
Registered: 4-2006
| | Posted on Thursday, June 15, 2006 - 11:09 am: | |
Why blue light appears white over a yellow surface ?  |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1304
Registered: 12-2004
| | Posted on Thursday, June 15, 2006 - 11:37 am: | |
See this page. |
Antariksh Bothale (Antariksh)
New member
Username: Antariksh
Post Number: 2
Registered: 5-2006
| | Posted on Monday, July 31, 2006 - 2:54 am: | |
Is it possible to get circuit for making puzzles using logical gates. I want to make one. |
I. Dimov (Overrider)
Advanced Member
Username: Overrider
Post Number: 81
Registered: 12-2005
| | Posted on Monday, July 31, 2006 - 12:13 pm: | |
Define puzzle. You can download a couple of programs from the net. |
J.D. Moore (Jdbabe11)
New member
Username: Jdbabe11
Post Number: 1
Registered: 9-2006
| | Posted on Monday, September 25, 2006 - 9:59 am: | |
I am currently in an engineering class that requires me to wrok with a group to build a trebuchet. We are thinking aboout building a FAT, but our treb can only be 24" on any side. So we were thinking about mounting the towers on the very front of the base. Do you think that would work, or would we be better off just building a traditional treb? Any help will be appreciated. Thnx. |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1502
Registered: 12-2004
| | Posted on Monday, September 25, 2006 - 10:48 am: | |
The FAT term stands for "Floating Arm Trebuchet":
"http://www.trebuchet.com/kit/fat/"
How tall can it be? If the weight is attached to a rope, so you can lift it
high and drop it, you will get more power. But that requires that the device
be as tall as possible, so the weight does not hit the ground.
Or I suppose you could dig a hole under the trebuchet to get around height
limitations ;-). |
Dr. Santosh Jalukar (Drjalukar)
New member
Username: Drjalukar
Post Number: 1
Registered: 11-2006
| | Posted on Thursday, November 16, 2006 - 6:11 am: | |
Stevia and Sorbitol, how the combination may work? Anybody has tried this? What are the results? |
Michael (Michaelt)
Senior Member
Username: Michaelt
Post Number: 128
Registered: 12-2005
| | Posted on Friday, November 17, 2006 - 4:02 am: | |
Sorbitol is a sugar alcohol which is metabolized very slowly -- although in some it can result in bloating and diarrhea, especially if taken in large quantities.
Stevia has about 300 times the sweetness of sugar, but it's not approved by the FDA as a food additive (a substance used to preserve flavor or improve its taste and appearance), but only as a food supplement. Essentially this means it can be sold in a 'health-food store' as a dietary supplement so long as it not marketed as a sweetener.
Often, artificial and alternative sweeteners have a synergistic effect increasing the sweetness of the finished product versus just using one sweetener, and minimizing the aftertastes that artificial sweeteners often have. This is why many diet colas have combinations of sucralose (Splenda (TM)), acesulfame potassium (Sunett (TM)), and sometimes aspartame (Nutrasweet (TM)) (although aspartame seems to be quickly falling out of favor with soft drink makers.) This synergy of sweetening may also apply to a stevia/sorbitol blend.
I use a liquid saccharin product in my iced tea-- the aftertaste is minimal in iced tea. For hot drinks, I use sucralose as the heat doesn't alter the flavor so much. (Aspartame is practically useless in hot drinks and in baking.)
I have not tried stevia, and I usually find sorbitol in things like toothpaste and gum or cough syrup.
BTW, Simon-- the code on this page is broken and it seems like a discussion thread is appended to the general index of threads. Disconcerting. |
Carter (Unregistered Guest)
Unregistered guest
Posted From: 209.91.177.176
| | Posted on Friday, November 17, 2006 - 9:39 am: | |
we are currently trying to get our film cannon cannon to actually consistently fire. We get a spark every time but the cannon only shoots infrequently!!! We are using Binaca as our fuel. Any ideas on how to make this cannon shoot consistently? |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1587
Registered: 12-2004
| | Posted on Friday, November 17, 2006 - 10:15 am: | |
Get good at delivering the same amount of fuel each time.
Also, make sure the can is warm enough -- rub it in your hands first. |
greg koz (Greg1118)
Advanced Member
Username: Greg1118
Post Number: 62
Registered: 10-2006
| | Posted on Thursday, November 23, 2006 - 7:39 pm: | |
Where is is it possible to obtane iodine crystals? Thanks for the help |
greg koz (Greg1118)
Advanced Member
Username: Greg1118
Post Number: 63
Registered: 10-2006
| | Posted on Thursday, November 23, 2006 - 7:39 pm: | |
Where is is it possible to obtane iodine crystals? Thanks for the help |
abderrezak (Daoudi)
New member
Username: Daoudi
Post Number: 1
Registered: 11-2006
| | Posted on Sunday, November 26, 2006 - 6:15 pm: | |
hi. i need anyone to help me.
i have an homework ,i am student in pharmacy
my homework is :
there is two spray " deep freeze" and "deep heat"
questions:
1-give the active ingredients " include the structures "
2-give thier use " active ingredient" in the formulation
3-comment on the cautions.
4-comment on the name "heat" "freez".
please anyone help me in " 3- and 4- " questions.
my e-mail: daoudi17@hotmail.com |
sseed (Unregistered Guest)
Unregistered guest
Posted From: 85.12.72.2
| | Posted on Friday, December 1, 2006 - 9:42 am: | |
Hi,
I have built the communicator project but Iam having problems getting it to work. I have used an Oscilloscope to see if a signal is being transfered to the power supply to the laser and it is. The laser works fine.
However when I try and receive anything with either a solar cell or an LDR I get nothing. An CRO on the receiver shows no signal either.
Could it be that Iam using a 1.3k ohm to 2x3.2 ohm transformer and it is just not putting enough signal onto the power supply? Or is it possible that the LDR cannot handle signal changes that fast?
Or do you think there could be a smoothing capacitor on the laser?
Stuart
BTW there seems to be a variable resistor on the laser, any idea what this is for? |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1590
Registered: 12-2004
| | Posted on Friday, December 1, 2006 - 10:57 am: | |
You could try the laser and transformer we offer in our catalog.
That combination is known to work.
You should be able to see the laser spot on the wall brighten and dim
with the sound volume. If that isn't happening, then you are not
modulating the beam properly. Try the transformer called for in the
instructions.
If the laser is being modulated properly, you can try a solar cell instead
of the cadmium-sulfide cell and battery. There are many types of CDS cells,
and yours may be damaged or inappropriate for this application. |
Corinne McGuckin (Cori)
New member
Username: Cori
Post Number: 1
Registered: 12-2006
| | Posted on Thursday, December 7, 2006 - 7:09 pm: | |
Hi. I am in 7th grade.
I am building the Linear Accelerator for our Science Fair.
What would be the hypothesis statement for the experiment?
I don't plan on testing variations of the set-up, I just want to do the
base experiment.
Right now I have something like "Due to the properties of magnetic fields, magnets can be used accelerate the motion of a steel ball".
But it's rather unwieldy and it doesn't sound quite right.
I appreciate any help.
Thank you. |
Eddie Adams (Magician)
New member
Username: Magician
Post Number: 1
Registered: 12-2006
| | Posted on Tuesday, December 26, 2006 - 6:14 pm: | |
I am a Magician, a very old one. I am trying to get a trick to work, maybe you can help me. Take a plastic bottle, (mine contained peanut butter).
unscrew the top, lay it face down and using Hot Glue, stick a needle into the center of the cap. Cut a peice of paper about one inches by two inches.
Fold the paper in half, lengthwise and balance it upon the point of the needle.
Carefully screw the bottle on to the cap.
Step back, concentrate a moment, rub your hands together, stepforward, place your hands on both sides of the bottle (without touching the bottle), and cause the paper to rotate.
Shove the bottle toward an onlooker and ask him to do it, He can't.
I think it can be done, using some sort of electrostatic device.
CAN YOU HELP ME MR.SIMON QUELLEN FIELD?
Waiting for your reply,
Magician Eddie
PS: I am mechanically and electrically enclined. |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1606
Registered: 12-2004
| | Posted on Tuesday, December 26, 2006 - 6:58 pm: | |
Martin Gardner, famous for the "Mathematical Games" column
in Scientific American, devised the "psychic motor" you describe.
"http://bizarrelabs.com/psychicm.htm"
"http://www.ericberlin.com/reader.html"
"http://www.time.com/time/magazine/article/0,9171,917342,00.html"
"http://www.findarticles.com/p/articles/mi_m2843/is_n1_v20/ai_17849131/pg_2" |
Corey Meyer (Unregistered Guest)
Unregistered guest
Posted From: 75.50.250.129
| | Posted on Sunday, January 21, 2007 - 3:57 pm: | |
Im just wondering if the little things you plug into your tv to recieve ir tranmissions can be used to tranmit? also what are some common places i could find a ir transmitter if that dosent work |
Randy G. (Unregistered Guest)
Unregistered guest
Posted From: 64.12.117.8
| | Posted on Sunday, January 21, 2007 - 4:17 pm: | |
I have a quick question,
What does an incoming signal from a telephone wire look like.. I'm talking about when the telephone rings. Is it a flat line or does it have some sort of digital signal?
Is it something I can duplicate?
Basicly my application is to use it with a wireless phone. When the phone rings it will use the buzzer to turn on or off the wireless "thing". This what I have a wireless remote.
Thanks,
-Randy |
Michael (Michaelt)
Senior Member
Username: Michaelt
Post Number: 152
Registered: 12-2005
| | Posted on Sunday, January 21, 2007 - 11:32 pm: | |
The battery voltage (DC) is nominally 48V (actually, -48V). The ringing voltage is often heard to be 90VAC, sometimes decared to be 88V but I've measured it as low as 55VAC before on POTS and have seen voltage selections ranging from 40 to 120VAC on a Nortel PBX (I suppose to accomodate different trunks in different countries). This voltage is superimposed over the DC, which is not disconnected when the ring signal is sent (otherwise, detecting the phone going off-hook (picked up) would not be detected.)
The frequency can be anywhere between 15 and 68Hz in the US. This is analog, not a digital signal.
An interesting application.
One thing to note is that wireless (mobile) and cordless phones generates their own rings internally and don't use the POTS voltage to do that (since they have no direct connection to a POTS.) |
Phil Collins (Opaphil)
New member
Username: Opaphil
Post Number: 1
Registered: 1-2007
| | Posted on Tuesday, January 23, 2007 - 5:50 pm: | |
How difficult is it to build the kit listed as 'building a radio in ten minutes?'
My 11 year old granddaughter has selected 'building a radio in ten minutes' for her science project. We have ordered the kit, actually 2 of them. I will attempt to make one with one of the kits first and then she will make the other one hopefully just with a bit a help from me.
My concern is how difficult is it to build the radio from the kit? I am a retired accountant by profession and when I look at the list of all the parts, I'm not sure I will be able to make one.
Any comments would be appreciated. |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1624
Registered: 12-2004
| | Posted on Tuesday, January 23, 2007 - 6:02 pm: | |
I like to think it is a simple project, but I have a good deal of experience
soldering up things like this.
There are three places to solder.
Two of those places join three things together, the other joins two things.
You will need a long wire antenna, placed as high as you can get it.
50 feet of wire will do for an antenna, but 500 feet will get better
reception. You can solder the antenna to one of the wires on the coil,
or you can just use an alligator clip to connect them.
The same goes for the ground wire, which should connect to a good ground,
such as a cold water pipe. A good ground is a piece of metal that is
buried in the ground for at least several feet (like a cold water pipe is).
If you want a project that is easier to demonstrate in a science fair
setting, the Three Penny Radio is also easy to put together, and it needs
no ground and no antenna, and it has a built-in amplifier to give you
good volume. |
hhs (Hhs)
New member
Username: Hhs
Post Number: 1
Registered: 1-2007
| | Posted on Thursday, January 25, 2007 - 12:08 pm: | |
I want to make a laser alarm.
Please help me.
Thanks,
hhs |
Michael Van Patten (Mvpart)
New member
Username: Mvpart
Post Number: 1
Registered: 2-2007
| | Posted on Thursday, February 1, 2007 - 1:41 pm: | |
Tracking Lights Back & Forth
I'm very much the Novice and would appreciate any guidance on where to start,
what to use or where to look, books to read or diagrams to follow, etc...
I'm trying to build a 12"(w) x 24"(h) x 2" (d) lightbox with
1-2 light sources (possibly small 40w incadecent bulbs TBD) which I can automatically
track back and forth (up and down) using a small motor which revolves VERY Slowly.
Also I'd like to set up the motor to a dimmer so that it turns the dimmer on
and off while simultainiously tracking the lights back and forth.
In addition I'd like to have another motor driven device which rotates a clear
disk of transparent film or patterned screen over the lights.
Thank you in advance
Michael Van Patten |
kislam (Unregistered Guest)
Unregistered guest
Posted From: 72.74.125.165
| | Posted on Sunday, February 4, 2007 - 10:46 pm: | |
Hi,
We are trying to build an AM radio transmitter for a school science fair project. Thank you for providing information in your website: (http://sci-toys.com/scitoys/scitoys/radio/am_transmitter.html)
However, I am a bit confused when I see that I have to connect the sound source with the high impedence side (1000 ohm) of the transformer. In another website (http://www.sciencebuddies.org/mentoring/project_ideas/Elec_p024.shtml?from=Home) I see the opposite of this i.e., the low impedence side of the transformer (8 ohm side) is connected with the sound source.
I would appreciate very much if you could please provide the accurate information on this.
Thanks in advance for your prompt response,
Kazi |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1631
Registered: 12-2004
| | Posted on Monday, February 5, 2007 - 10:13 am: | |
Some devices are meant to drive higher impedance headphones, such
as 32 ohms or 16 ohms. Those devices don't have the power to drive
the transmitter unless the transformer is turned around. However, doing
so will reduce the range. |
Freddie Colllier (Unregistered Guest)
Unregistered guest
Posted From: 67.176.128.198
| | Posted on Wednesday, February 7, 2007 - 6:30 pm: | |
i need help! I am currently in 8'th grade and i have to come up with an invention. For my invention my group is planning to make something that can sweep or vacume up crumbs from the floor os that old people do not have to bend over and possibly throw out their backs when they sweep. my group is planning to build off of this robot ( http://www.henrys.co.uk/gadget/hyper%20peppy.html) their are a few problems:
1. the wild spastic movement of the robot will scare old people and it will be too hard for them to catch.
2. Neither one of us have any experience in building robots.
3. We dont have any ideas that can slow down the robot (hoping to make it scan for crumbs is too much like the "Roomba" right? could we get sued?)
4. How could we attach a small enough broom, shovel or or vacume?
I know this is a lot of stuff and since i cannot bookmark this page and may lose it, can you post your responses here can email them to me @ chaosrules221@gmail.com |
Freddie Collier (Chaosrules221)
New member
Username: Chaosrules221
Post Number: 1
Registered: 2-2007
| | Posted on Wednesday, February 7, 2007 - 7:26 pm: | |
same person, i just signed in :-) <(^_^)>
i need help! I am currently in 8'th grade and i have to come up with an invention. For my invention my group is planning to make something that can sweep or vacume up crumbs from the floor os that old people do not have to bend over and possibly throw out their backs when they sweep. my group is planning to build off of this robot ( http://www.henrys.co.uk/gadget/hyper%20peppy.html) their are a few problems:
1. the wild spastic movement of the robot will scare old people and it will be too hard for them to catch.
2. Neither one of us have any experience in building robots.
3. We dont have any ideas that can slow down the robot (hoping to make it scan for crumbs is too much like the "Roomba" right? could we get sued?)
4. How could we attach a small enough broom, shovel or or vacume?
I know this is a lot of stuff and since i cannot bookmark this page and may lose it, can you post your responses here can email them to me @ chaosrules221@gmail.com |
jimmydharia (Unregistered Guest)
Unregistered guest
Posted From: 202.88.141.233
| | Posted on Thursday, February 22, 2007 - 1:25 am: | |
hey i in engineering final year n i m making a project in which i have t communicate between two pc wirelessly plz.. tell me the various option i m really confused i tried the pc based morse code circuit but then i has no circuit for a receiver just a radio n the range is bad pl.. help m wit this urgently |
jimmydharia (Unregistered Guest)
Unregistered guest
Posted From: 202.88.141.233
| | Posted on Thursday, February 22, 2007 - 1:34 am: | |
hey i m in my final yer engineerin n i m working on a project in which i need
to communicate between two pc's i tried the morse code circuit bt then the range is bad can aqny one suggest me other methods for comminication n also the pc based transittr has no receiver circuit i need a circuit that will first encryt my text nthen transmit it plz. i need help ugetly |
Bob_g (Bob_g)
New member
Username: Bob_g
Post Number: 1
Registered: 2-2007
| | Posted on Friday, February 23, 2007 - 5:03 pm: | |
On the Gauss Rifle project, I’m looking for suggestions on measuring the relative output energy for different magnet configurations (number, position, type, etc.). Been considering a weighted target on the end of a pendulum arm and then measuring and comparing the angles that the arm swings for each config.
Any other suggestions out there that are simple to implement and repeatable?
Thanks!
Bob |
Amauboussin (Unregistered Guest)
Unregistered guest
Posted From: 69.120.91.62
| | Posted on Wednesday, February 28, 2007 - 7:46 pm: | |
Does anyone know where I can get steel balls for the gauss rifle? |
ofarrelld (Unregistered Guest)
Unregistered guest
Posted From: 143.239.130.189
| | Posted on Friday, March 2, 2007 - 4:32 am: | |
Hi I was just wondering if anyone knew the strength of the magnetic field generated by the 12mm cube magnets?? |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1645
Registered: 12-2004
| | Posted on Friday, March 2, 2007 - 11:46 am: | |
They are 50 MegaGaussOersteds.
As the technology improves, we will always have the most powerful magnets
available. At the time of this writing, that is 50 MGOe. |
ofarrelld (Unregistered Guest)
Unregistered guest
Posted From: 89.234.114.88
| | Posted on Saturday, March 3, 2007 - 10:20 am: | |
Thanks for the reply but I'm still a little confused. I've never came across those units before, I gather that t=its to do with the prduct of B and H but would you have any idea of say the magnetic field strength, in gauss, between two of these magnets about 10 inches apart?? Thanks for the help. |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1646
Registered: 12-2004
| | Posted on Saturday, March 3, 2007 - 4:41 pm: | |
What is it you need to do with the magnets?
You are asking for gauss, which is like asking for current in
an electrical circuit. Without knowing the voltage also, it is
hard to compare two things by current alone.
The total energy product of a magnet is similar to watts in an
electrical circuit. It is the product of the intensity of the
field and the flux.
A larger magnet will have more flux, but not more intensity.
This is like having a larger hole in a dam. You have more flow,
but the same pressure.
For some applications, the intensity of the field is more important
than the amount of flux. For a spark plug, the voltage is more
important than the current. Not enough voltage, and you don't get a
spark.
In applications like the Gauss Rifle and the magnetic levitation
projects, what matters is the total energy product divided by the
mass.
In the end, it may make no difference to you. These are the most powerful
magnets currently available. When the technology improves, we will offer
the improved magnets. |
ofarrelld (Unregistered Guest)
Unregistered guest
Posted From: 143.239.130.189
| | Posted on Wednesday, March 7, 2007 - 7:38 am: | |
Thanks for the reply, I think I've figured out what you mean by the energy product. I was planning on using them to create a magnetic field in a plasma device to increse the confinment. |
Daniel (Unregistered Guest)
Unregistered guest
Posted From: 24.28.78.210
| | Posted on Saturday, March 10, 2007 - 10:35 pm: | |
I need some help with my Van de Graaf generator please look at my subject that says SERIOUS VAN DE GRAAF PROBLEMS. I would really enjoy some help. |
whatever whatever (Unregistered Guest)
Unregistered guest
Posted From: 71.102.14.163
| | Posted on Saturday, March 31, 2007 - 2:42 pm: | |
I was reading the laser data transmitter page and i couldn't find the morse code software for mac? sorry, I couldn't use my real name. |
Randy (Unregistered Guest)
Unregistered guest
Posted From: 205.188.116.8
| | Posted on Saturday, March 31, 2007 - 6:41 pm: | |
With the Digital thermometer... you had said it didn't need a reference temp so my question is since this makes electricity does it make electricity directly from the heat? If so could you make a bunch of these and make a small "battery" powered by the air temp?
-Randy |
Randy (Unregistered Guest)
Unregistered guest
Posted From: 205.188.116.8
| | Posted on Saturday, March 31, 2007 - 6:47 pm: | |
Nevermind I just reread the page and I saw a 9v battery... so nevermind about what i just said.
-Randy |
James (Teamsr195)
New member
Username: Teamsr195
Post Number: 1
Registered: 7-2007
| | Posted on Thursday, July 12, 2007 - 8:03 pm: | |
I am trying to build a motor that will run on a cable. I need the motor to be able to support about 10 pounds with a variable speed control. I would like to be able to run a max of about 15 mph. Also once the pully reaches the end of the cable I need it to have a switch that will trip and reverse the polarity so it will go forward and reverse. What do I need to make this work? I have a basic idea but have never built anything like this before. |
Haz (Pyrohaz)
Intermediate Member
Username: Pyrohaz
Post Number: 31
Registered: 8-2006
| | Posted on Friday, August 10, 2007 - 4:44 am: | |
Hi, i was wondering, which kind of light will suit best for my electric scooter, would it be:
1. LED's at 5v (the 5v being converted down from 24v using an 7805 regulator)
2. Halogens at 12v (using an 7812 regulator)
3. Anyone got any other ideas? |
Maria Teresa Pombo (Maria_teresa)
New member
Username: Maria_teresa
Post Number: 1
Registered: 8-2007
| | Posted on Monday, August 20, 2007 - 9:33 am: | |
Hi My son is an honor student who just started his 8th grade. He has entered Science Fairs in his school for two consecutive years. He won First Place in his school for a project measuring static in several materials and then won third place in the Regional Fair. Last year, he competed in the area of physics and structures with a project that analyzed the strength of the spider web and did an experiment with LEGO blocks to see whether a building supported with a spider like web would withstand stronger hurricane force winds than the unsupported one . He again won first prize at his school and this time second place in the Regional Fair.
This year he is interested in pursuing a project on electromagnetic levitation and would like to propose to do an experiment on whether gravity could affect the growth of bacteria in Petri dishes. The problem is to have the bacteria experience weightlessness with a gravitational force. Is this something that could be done? Could you offer us some suggestions? Any other projects you could suggest for him to pursue using this topic? We saw the post from an 8th grader that was interested in doing a similar project and your response but we could not find much information on how to build a decent sized water cooled electromagnet to be able to have the bacteria experience weightlessness.
We would deeply appreciate your guidance and valuable time. Any other suggestions for a project on this topic would be appreciated. |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1772
Registered: 12-2004
| | Posted on Monday, August 20, 2007 - 10:42 am: | |
The kind of electromagnet used to levitate water is a Bitter Solenoid.
They are generally out of reach for amateurs, since the power and water
requirements are those of a small town, not a small house.
However, just as people floating in water experience simulated weightlessness,
a bacterial culture in a liquid medium should also not be able to tell up
from down if the medium had the same density as the organism.
Determining whether weightlessness was the cause of differences (as opposed to
surface effects, diffusion, differences in culture media, etc.) might be
difficult. But rotating the culture on a Ferris-wheel type of structure
might be simulation enough. |
Maria Teresa Pombo (Maria_teresa)
New member
Username: Maria_teresa
Post Number: 2
Registered: 8-2007
| | Posted on Monday, August 20, 2007 - 3:32 pm: | |
Thanks so much for your prompt response. We will research a possible liquid medium with the same density as the organism in the Petri dish. It seems pretty hard though. Rotating the culture on a Ferris-wheel type structure sounds like a better alternative.
We have searched the area of biomagnetism/bioelectromagnetics and think that a project dealing with this area would be extremely interesting. Any suggestions as an alternative project? |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1773
Registered: 12-2004
| | Posted on Monday, August 20, 2007 - 3:43 pm: | |
Several soil bacteria use magnetism to know which direction is 'up'
(since everywhere except the equator, a compass needle points down
as well as north, and the farther north or south, the more down it points).
You might see if you can capture and isolate them by stirring mud with
a lot of water in a bucket, and holding a large or strong magnet to the side
of the bucket. Then culture them to further isolate magnetic species.
It might also be interesting to see whether magnetic species are predominantly
aerobic or anaerobic. They may be heading down to avoid oxygen. |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1774
Registered: 12-2004
| | Posted on Thursday, August 23, 2007 - 11:40 am: | |
If your son is still in the process of picking a topic, instead of trying to
control gravity, it is much easier to control magnetism. Seeing what effect
strong magnetic fields have on colony growth of various bacteria in an agar
plate could be quite interesting.
Questions such as "Are anaerobic microorganisms more likely to be affected by
a magnetic field than aerobic organisms" might be an interesting topic. The
hypothesis that organisms use the magnetic field in order to avoid oxygen
would be tested. |
Maria Teresa Pombo (Maria_teresa)
Junior Member
Username: Maria_teresa
Post Number: 4
Registered: 8-2007
| | Posted on Thursday, August 23, 2007 - 12:07 pm: | |
Thanks so much!! We will pursue your suggested topic instead!! |
paulo melendez (Paul0)
New member
Username: Paul0
Post Number: 2
Registered: 9-2007
| | Posted on Saturday, September 1, 2007 - 8:51 am: | |
"You can build your own earphones using a tin can, a nail, a small magnet, and some fine wire. Wind a few hundred turns of wire around the nail. Let the magnet stick to the head of the nail (a neodymium-iron-boron supermagnet in our catalog works well here, since it is strong and very small). Attach the coil to the radio in place of the earphones. Hold the open end of the tin can to your ear, and hold the nail very close to the bottom of the tin can. The bottom of the can will be attracted to the magnet, but the coil will make it vibrate with the sound from the radio."
Can i get a photo of this? Thanks in advance |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1786
Registered: 12-2004
| | Posted on Saturday, September 1, 2007 - 12:45 pm: | |
While I enthusiastically support people building their own
magnetic earphones, I should point out that the materials
for making one are more expensive than buying a piezoelectric
earphone and the latter is smaller, lighter, and more sensitive. |
jack william (Unregistered Guest)
Unregistered guest
Posted From: 67.184.24.225
| | Posted on Thursday, October 25, 2007 - 8:27 pm: | |
What factors effect the balance of a sphere on a flat surface? |
Gokul Sriram (Dgpride)
New member
Username: Dgpride
Post Number: 2
Registered: 11-2007
| | Posted on Saturday, November 17, 2007 - 2:46 pm: | |
I have come to know about "Building a computer controlled radio transmitter". While doing this, won't it affect motherboard??? how much power will it draw to transmit signal using 1MHZ crystal oscillator??? wt's the maximum frequency i can use? how much an oscillator will cost??
 |
Gokul Sriram (Dgpride)
New member
Username: Dgpride
Post Number: 3
Registered: 11-2007
| | Posted on Saturday, November 17, 2007 - 2:53 pm: | |
cont....
 |
moustafa ibrahim moustafa (Mosnfady)
Junior Member
Username: Mosnfady
Post Number: 4
Registered: 5-2007
| | Posted on Monday, December 3, 2007 - 12:13 pm: | |
hi, i need a help plz to get an idea or any device ( ready ) that can know the place of my lost sheep, my uncle is a sheepherder , and always have a problem ( loss one or two sheep )in the desert, |
Le'Andre Bean (Leandrebean)
New member
Username: Leandrebean
Post Number: 2
Registered: 12-2007
| | Posted on Saturday, December 8, 2007 - 11:18 pm: | |
I was wondering if anyone knows about the computer controlled transmitter? I love it and I am interested in trying it but would like to know if you can use a HC-49\U package crystal oscillator (the kind used in R/C cars) and if so how exactly would you do so? Thanks in advance!!! |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1813
Registered: 12-2004
| | Posted on Monday, December 10, 2007 - 9:58 am: | |
Those are crystals, not crystal oscillators.
You need the four legged parts, not the two legged ones. |
Syed Haider Abbas (Haider_abbas)
New member
Username: Haider_abbas
Post Number: 2
Registered: 12-2007
| | Posted on Sunday, December 30, 2007 - 12:07 pm: | |
hello,
i am your new friend.Please respond me.I have a problem.I want to make a RC car but the big problem is RC transmitter and receiver.
So please tell me how to make RC transmitter and receiver i want a cool RC car. The another big problem is the engine.I don,t know that from which material i can make engine i want an electric engine. |
Tim Dietenhofer (Timdietenhofer)
New member
Username: Timdietenhofer
Post Number: 1
Registered: 1-2008
| | Posted on Monday, January 7, 2008 - 1:13 pm: | |
I have just built your "a simple laser communicator" and the audio is so faint in the earphone I can hardly hear it. I am using everything you suggest in your parts list. the only success I have had to get it louder was to buy an expensive high power laser pointer from Staples.
Is there something else I could have done? |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1826
Registered: 12-2004
| | Posted on Monday, January 7, 2008 - 2:22 pm: | |
The power of the laser has no effect on the sound volume.
That would only affect the range.
To make the sound louder, increase the volume of the device that you
are using for the signal source, or amplify the output from the solar cell. |
Tim Dietenhofer (Timdietenhofer)
New member
Username: Timdietenhofer
Post Number: 2
Registered: 1-2008
| | Posted on Monday, January 7, 2008 - 9:49 pm: | |
"a simple laser communicator"
I have the volume turned all the way up on the signal source (a radio), how can i amplify the output between the solar cell and the earphone - a battery? |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1828
Registered: 12-2004
| | Posted on Tuesday, January 8, 2008 - 9:42 am: | |
Try a different radio. It sounds like the radio you are using is
designed to drive 16 or 32 ohm earphones instead of 8 ohms. That
means it does not have enough power to send a loud signal to the
laser. An alternative is to turn the transformer around, so the
three leg side is connected to the radio, and the two leg side to
the laser.
You can tell when the laser is properly modulated because the sounds
from the radio will make the laser visibly dim and brighten with
the music.
To amplify the signal at the other end, connect the photocell to a
cable that plugs into the input of an amplifier, such as a stereo
or tape recorder, instead of to the earphone. |
Tim Dietenhofer (Timdietenhofer)
New member
Username: Timdietenhofer
Post Number: 3
Registered: 1-2008
| | Posted on Tuesday, January 8, 2008 - 11:53 pm: | |
The radio output is 8 ohm (checked with a meter). the xfmr has 8 ohms on the two leg side and 680 ohm on the three leg side (rated 1000, is it defective?).
When connected as per diagram the laser lights up but does dim or brighten although the Led does pulse when I increase the volume.
(when I reverse the transformer there is no audio at all)
As I asked earlier, how loud should the audio be if this thing is working right (using the piezoelectric earphone and a solar cell)? at the moment it is so faint you can hardly hear anything.
I feel like an idiot, as this is a simple project, but do not see where I have gone wrong. |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1832
Registered: 12-2004
| | Posted on Wednesday, January 9, 2008 - 9:38 am: | |
You can't check the output impedance of a radio with a ohmmeter.
Likewise, the impedance of a transformer can't be measured with an ohmmeter.
It is specified in ohms, but at 1,000 hz AC, not DC.
The volume should be comfortable, not faint.
Your transformer is fine.
Try different radios as the sound source. |
Tim Dietenhofer (Timdietenhofer)
Junior Member
Username: Timdietenhofer
Post Number: 4
Registered: 1-2008
| | Posted on Saturday, January 12, 2008 - 1:04 am: | |
"A simple laser communicator"
Well It turned out to be the laser I purchased at Radio Shack!
A word of advice to those trying this experiment...the cheap lasers they sell are too weak to put out a strong enough signal to be heard.
I ended up using a laser/light/pen I got as a Xmas gift from a customer and it worked great.
Thanks for your help. |
Ichabod Crane (Unregistered Guest)
Unregistered guest
Posted From: 65.57.245.11
| | Posted on Tuesday, January 22, 2008 - 11:29 am: | |
It sounds more like the laser was too "stiff" to modulate,
rather than not strong enough. In other words, the light was
bright enough, but the transformer could not make it change
brightness. |
Julie Mehta (Unregistered Guest)
Unregistered guest
Posted From: 205.188.116.8
| | Posted on Monday, January 28, 2008 - 8:18 am: | |
Hi,
I have a question regarding my kids science fair project. We want to show bacteria growth on lots of different surfaces. I was wonein how far in advance can you do this before the show. I have read online and it seems to take about 48 hours in a dark place to grow the bacteria. I want to do this as far ahead as I can so we do not wait until the last minute to get the project done.
Does the bacteria keep growing one it is in the light. Does it stay the same.
Any advice would be apreciated.
Thanks.
Julie |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1849
Registered: 12-2004
| | Posted on Monday, January 28, 2008 - 8:55 am: | |
Bacteria will continue to grow.
If you want to stop growth, put them in the freezer. |
Julie Mehta (Unregistered Guest)
Unregistered guest
Posted From: 205.188.116.8
| | Posted on Monday, January 28, 2008 - 12:58 pm: | |
Thanks for th info. about the bacteria growth. I have another question. I wanted to get samples from playground equiptment but it is winter here. Will there still bacteria on the playground toys in the cold. I am new to this so I appreciate your help. I just don't want to take samples if it isn't the right time.
Thanks again. |
Theresa Simmons (Theresa)
Junior Member
Username: Theresa
Post Number: 4
Registered: 1-2008
| | Posted on Monday, January 28, 2008 - 5:20 pm: | |
If there is dirt on the equipment, the bacteria there will grow fine once
you warm it up inside. |
Hope Spellman (Unregistered Guest)
Unregistered guest
Posted From: 76.6.78.223
| | Posted on Thursday, January 31, 2008 - 7:50 pm: | |
I need help coming up with a science fair project |
Randy G. (Unregistered Guest)
Unregistered guest
Posted From: 76.5.106.57
| | Posted on Saturday, February 2, 2008 - 9:37 pm: | |
Question here:
"What is the easiest way to transfer a complex circuit onto a circuit board for ecthing?" I have the circuit on the computer.
I don't have photo sensitive boards. I do have an Inkjet print but not a laser printer.
Sharpies are no good for this circuit because it is too big and too complex.
Any Help would be GREAT
-Randy |
steven brierley (Steve10)
New member
Username: Steve10
Post Number: 1
Registered: 4-2008
| | Posted on Monday, April 21, 2008 - 8:21 am: | |
Question please:
I am going crazy, trying to figure out, on how to build a simple "beep circuit". What makes the sound? I just wwant to create a simple loop, with a push button, where I can make a beeping sound ( like the sound of a microwave touch pad). I have batteries, speakers,push buttons, wires, ect. everyhting I believe I need to make the simple loop, except what acually makes the beep sound itself. please help
Thanks, steve |
vaishali mahiras (Vaishu3912)
New member
Username: Vaishu3912
Post Number: 1
Registered: 8-2008
| | Posted on Wednesday, August 13, 2008 - 7:10 am: | |
ineed help in my project, of producing electricity by compreesed air. |
Rohan (Digital)
Senior Member
Username: Digital
Post Number: 125
Registered: 3-2008
| | Posted on Wednesday, August 13, 2008 - 10:21 am: | |
take compressed air in a tank and make a small opening in that and attach a valve with it then take a low rpm motor or ur generator and attach a turbine with it and place it near the tank near the opening. open the valve and the turbine will move and ur generator will produce electricity.
are u from india? |
Don Root (Signbonkers)
New member
Username: Signbonkers
Post Number: 1
Registered: 8-2008
| | Posted on Saturday, August 23, 2008 - 3:53 am: | |
Wow! Awesome site, everybody... I am trying to build a set of bone conduction headphones to wear at work. I work in an incredibly loud production environment where we wear those 'squishy' foam earplugs 12 hours a day. It would be cool to be able to listen to music while I work, but OSHA regulations won't let us wear any kind of covering directly over our ears (walkman type ear phones, ear muffs, etc.) From what I've read, bone conduction headphones make a lot of sense, but I haven't had much luck in finding 'Bone Conduction Headsets R us' in my local phone book.
Plus, it'd be way cooler to build my own set. Any thoughts? -Don Root |
idimov (Unregistered Guest)
Unregistered guest
Posted From: 78.142.26.88
| | Posted on Saturday, September 20, 2008 - 5:39 am: | |
Hello, it's me I. Dimov. I finally managed to get the radio working. Turns out it was my solder joints and the diode. So just to give a few tips. If you can't find a Germanium, a 1N5819 Schottky diode, would work great. Use a wire loop antenna. Use the LM386 amp. Anyways, SQL, could you post another radio project, for example a superheterodyne receiver? |
aaron cortelyou (Chekhonte)
New member
Username: Chekhonte
Post Number: 1
Registered: 11-2008
| | Posted on Thursday, November 6, 2008 - 10:05 am: | |
I'm trying to build a ferrofluid sculpture and need to build a pretty powerful electromagnet but I need help choosing a power supply and determining the amount and diameter of magnet wire to use. If you do a search on youtube for ferrofluid you can find one of the sculptures I'm talking about. The first or second choice will be morpho towers. It's pretty amazing stuff.
How many amps should my DC powersupply be? Will 30 watts be enough? Where would you recommend getting a power supply? My only limitation is expense. I don't want to spend more than 450 dollars on the power supply.
Thanks in advance for any help and advice that you may give!
Aaron Cortelyou
PS How do you create a new topic?! |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1922
Registered: 12-2004
| | Posted on Saturday, November 8, 2008 - 6:03 pm: | |
The strength of an electromagnet depends on two things.
The current, and the number of turns.
The diameter of the wire should be big enough to handle the current.
The voltage of the power supply and the resistance of the wire will
determine the current.
The length of the wire will determine the resistance.
Obviously, you will need to know how many ampere-turns of magnetic field
you want in order to determine the current and the number of turns. That
is information you have not supplied.
A car battery would be a fine power supply for a large electromagnet. |
Darrin Sir (Dedub)
New member
Username: Dedub
Post Number: 1
Registered: 11-2008
| | Posted on Tuesday, November 18, 2008 - 7:52 pm: | |
Hello, I just put together the simple am transmitter but it doesn't seem to work. I can here dead space on 1000 Khz but nothing from the input I'm using. I've tried two different MP3 players, flipping the audio transformer and swapping out the oscillator (I bought two). When I unplug the power from it I get the normal am rush on the radio but like I said, when powered up, I get dead air. Has anyone else had this issue?
Darrin |
Theresa Simmons (Theresa)
Advanced Member
Username: Theresa
Post Number: 77
Registered: 1-2008
| | Posted on Tuesday, November 18, 2008 - 8:06 pm: | |
The static is quieting, so your oscillator is working fine.
Your problem is that you aren't modulating it.
This is usually caused by a weak input signal.
Try a radio or other source that uses an 8 ohm earphone,
instead of the 32 ohm stereo phones that MP3 players
usually use.
Of course, you could be connecting to the MP3 player
wrong. If you put an 8 ohm speaker instead of the
transmitter, you should be able to hear the signal.
If you can't, get a better signal source, or amplify
the one you have. |
Darrin Sir (Dedub)
New member
Username: Dedub
Post Number: 2
Registered: 11-2008
| | Posted on Saturday, November 22, 2008 - 7:54 pm: | |
Thanks Theresa,
Great suggestions but I figured out what was wrong. The page that has the instructions on how to construct the transmitter is wrong. First, the transformer that is displayed is not the one that showed up at the door. The schematic shows the transformer with a tap at the input side and has a 1000 ohm impedance. The one in the pictures also have the leads color coded. The one I got the leads are not color coded and the tap is on the other side of the transformer. Therefore, I had the transformer backwards the whole time but I was just following the schematic. I'm good to go now!
Thanks
Darrin |
Dudley Swiney (Unregistered Guest)
Unregistered guest
Posted From: 98.212.163.55
| | Posted on Sunday, January 11, 2009 - 11:56 pm: | |
Hi,
My son and I are working on some electronics projects. I remember in middle school shop class making this simple shocker I wanted to do with him.
It was based around a transformer we wound ourselves. On one side was a d battery and switch. on the other size of the transformer it was just two pieces of copper tubing that you would hold on to while your "friend" pulsed the switch. It was a good jolt when you could cycle it fast enough.
so my problem is I can't remember the details of the transformer. Could someone help me. I don't remember what was at the middle or what kind of wire we used. It seems like we wrapped a small amount of wire around a nail or something. Then wrapped a larger amount around the first coil of wire.
Any suggestions as to how to make this transformer, that would be suitable for 9yos? Tell me what to use at the center, what type of wire to use, how many turns each, do I just wrap one set on top of the other and other things I don't know to ask.
(I know I could use a ready made transformer, but this kid needs things to do.)
Your help is greatly appreciated.
Dudley |
John Michaels (Has91)
New member
Username: Has91
Post Number: 1
Registered: 1-2009
| | Posted on Monday, January 12, 2009 - 8:25 pm: | |
Hi. I’m doing a science project in high school, in which I dismantled a microwave, and took the microwave magnetron, capacitor (no need to worry; the capacitor was discharged) and transformer out.
Before I go on, the premise of the project was to get a magnetron to emit a microwave, which would be received by a rectenna (composed of an isolated microwave antenna—in this case a wi-fi antenna, connected by wire to a Schottky diode) which rectifies the AC current and turns it into DC current. In other words, wireless power transmission.
Now, I’m particularly having trouble with the transformer. I’m planning to hook up the apparatus to a variable power supply, in which in the science classroom, has an outlet that you can put wires into. One hole is for positive current, another is for negative current.
The variable power supply is in one room, the outlet for the two holes is in another.
This poses a problem, as I have a normal electrical plug (you know, for common household electrical outlets) for the microwave (which is connected to the control board AND eventually to the transformer). The transformer is a step-up transformer. The input has two flat knobs (almost like those on an normal electrical plug), and the output has other knobs that I was able to connect to the capacitor and the magnetron via wire. I supplied the link to a diagram of the transformer at the end of this post.
I’d like to bypass the controls and be able to directly wire the transformer to the variable power supply via the two holes (+ and -) instead of plugging it into the electrical outlet, that way I can directly control the voltage of the current going into the transformer, instead of having a steady voltage from the normal electrical outlet.
How can I make this possible? I don’t know how to distinguish between the two input knobs on the transformer (where to plug into positive and where to plug into negative).
I was wondering if it was possible I can use 18-gauge wire to connect into the two variable power supply holes, and connect it to the two input knobs on the transformer via alligator clips.
Here is the link to a diagram of a transformer that is extremely similar to mine:
http://www.gallawa.com/microtech/images/xform.gif
Pardon me for the extremely long explanation (more info is better than less).
I would greatly appreciate your help.
Thanks,
Has09
(Message edited by has91 on January 12, 2009) |
Theresa Simmons (Theresa)
Advanced Member
Username: Theresa
Post Number: 100
Registered: 1-2008
| | Posted on Monday, January 12, 2009 - 9:43 pm: | |
It sounds like your variable power supply is providing direct current.
Transformers need alternating current.
I presume the reason you want the variable power supply is to limit
the amount of power you put into the magnetron, so you don't cook
all the people around it.
A microwave oven puts out about a kilowatt when run on 120 volts AC.
That's about 8 and a third amperes of current.
Assuming you want no more than about 50 milliwatts of output, so you
don't cause cataracts in all the bystanders, you will want to reduce
the power by a factor of 20,000. The final voltage would then be 6
millivolts. A variable AC power supply that can supply 8.33 amps at
6 millivolts might be hard to find.
Keeping the voltage at 120 volts, but limiting the current to 40 milliamps
might be a more tractable solution. Or use a cheap AC wall-wart transformer
to both limit the current and reduce the voltage.
Something like this:
"http://parts.digikey.com/1/parts/730463-transformer-wall-24vdc-50ma-212as24005.html"
The output is 24 volts at 50 milliamperes. That's still 1.2 watts,
but you can get this one instead:
"http://www.digikey.com/scripts/DkSearch/dksus.dll?Detail&name=T701-ND"
which is 9 volt output at 100 milliamps, or 0.9 watts. That may be close
enough, and you can always put a resistor in series at the output to
limit the current further. Add a variable resistor, and you have a
variable AC power supply. |
John Michaels (Has91)
New member
Username: Has91
Post Number: 2
Registered: 1-2009
| | Posted on Monday, January 12, 2009 - 10:30 pm: | |
Ms. Simmons,
Thank you for your help. The variable supply box has several DC settings and one AC setting (voltage is adjustible), so I think it'll suit me. The links were helpful as well.
Is it possible to shield the microwaves emitted by the magnetron? (do they travel in a straight line from the magnetron itself?)
Also, given that I will be using the AC current setting, I have a question... There are two terminals in the wall, with one hole per each (presumably in which I can insert the wire). One terminal is red (indicating positive current) while the other is black. I would like to bypass the microwave's controls (with the menus) as well as the connectors to the lightbulb and the fan, so I'm wondering if I can -not- use the microwave oven's electrical plug. There are two flat knobs for the input into the transformer, so is it possible to directly connect the terminal to the transformer?
Thanks very much,
John Michaels |
Theresa Simmons (Theresa)
Senior Member
Username: Theresa
Post Number: 101
Registered: 1-2008
| | Posted on Tuesday, January 13, 2009 - 12:24 am: | |
The power supply can probably source more current than you can safely use.
The magnetron will emit microwaves in many different directions at once.
I have been assuming you or the person providing the power supply and
the venue were aware of the dangers of both 120 VAC power and microwave
energy, but in view of your questions that may have been optimistic.
You need to be absolutely certain that the input power to the magnetron
is limited to safe levels. I would not exceed 50 milliwatts. That means
measuring both the voltage and the current simultaneously, and making sure
that the product of the two (volts times amps) does not exceed 0.050 (watts).
A small transformer such as the one in the second link I provided can only
source 100 milliamperes of current, and provides 9 volts, making the nominal
power under one watt. In practice, a short circuit would probably exceed a
watt by a little bit. Putting a resistor in series with the output of the
transformer would limit the current (and thus the power) to safe levels.
The foregoing is all based on the assumption that the magnetron will even
work at reduced voltage. This may not be the case. If getting the magnetron
to emit microwaves requires that 120 volts be provided at the input, then
the current will have to be limited much further.
An easy and fairly safe way to do this is to get two of the small transformers,
and connect their secondaries together. The first transformer will reduce the
current to safe levels, and the voltage to 9 volts. The second one, because
it is reversed, will raise the voltage back to 120 volts, while keeping the
total power output below a watt (and thus the current to about 8 milliamperes).
A current limiting resistor would still be a good idea. Measure the current,
and the voltage, and use Ohm's Law to calculate the resistor needed to limit
the current until the output power is below 50 milliwatts.
You will want to shield the microwaves to keep them away from people, even
at these lower levels. Aluminum foil will work, as long as the entire project
is surrounded by the foil (except for the insulated wires providing power
and the output of the receiver). Sheet metal will also work, and will be less
likely to leak, since it is less likely to tear apart during transport. |
high school modder (Unregistered Guest)
Unregistered guest
Posted From: 122.106.173.27
| | Posted on Tuesday, February 10, 2009 - 3:47 am: | |
Does anyone know where there is a basic small turbine blueprint? Its for an electronics major work for my school certificate (final Australian test before you leave school) but i cant find one anywhere. It should be powered by motion (hydroelectrical) which would power an amp i also plan to make. Magnets i have but super magnets is not an choice. It would need to produce 9 volts hopefully. Anyone ideas? |
george harris (Rcking)
New member
Username: Rcking
Post Number: 1
Registered: 3-2009
| | Posted on Wednesday, March 11, 2009 - 3:08 pm: | |
hey I am looking into buying a nitro RC car and I was wondering if anybody knew of any webstites or brands that would have cars that are reliable?
Thanks |
Jennifer (Unregistered Guest)
Unregistered guest
Posted From: 72.69.143.171
| | Posted on Sunday, March 15, 2009 - 6:40 pm: | |
How can I make a model of a hydroelectric plant? |
Kayla S. (Unregistered Guest)
Unregistered guest
Posted From: 72.69.143.171
| | Posted on Sunday, March 15, 2009 - 6:43 pm: | |
How can I make a model of a hydroelectric plant? |
JimS (Jimmy101)
Junior Member
Username: Jimmy101
Post Number: 5
Registered: 2-2007
| | Posted on Monday, March 16, 2009 - 3:47 pm: | |
Kayla S. asked;
How can I make a model of a hydroelectric plant?
Do you want to build a working model?
The tricky part is coming up with the water turbine. Basically, the turbine is a propeller blade inside a housing. As the water goes through the housing it forces the blade to turn. A generator is attached to the blade's axle to generate electricity.
Coming up with a suitable housing and blade, then figuring out how to seal the axle's hole where it exits the housing will be the hard part.
On possibility would be to try using a "drill pump" as the housing / propeller / axle setup. Perhaps one of these;
http://www.northerntool.com/webapp/wcs/stores/servlet/ProductDisplay?storeId=6970&productId=11948&R=11948&cm_ven=TL&cm_cat=ERK&cm_pla=Google&cm_ite=pump
http://www.idealtruevalue.com/servlet/the-55405/Detail
Your local hardware store might carry something similar.
Use an elevated bucket of water as your "lake". Connect the "lake" to the turbine (the drill pump) with a length of garden hose.
Connect the axle of the "drill pump" to a small electric motor (perhaps a Scitoys homemade motor). Connect the wires from the electric motor to a volt meter or, if you get enough power out of the setup, to a small light bulb.
The higher your "lake" is above the turbine the more power the turbine will generate.
A tricky part will be coming up with a way to connect the axle of the drill pump to the axle of the motor. Perhaps use a short length of rubber tubing? |
J N (Newty)
New member
Username: Newty
Post Number: 3
Registered: 5-2009
| | Posted on Monday, May 11, 2009 - 1:50 pm: | |
Kayla S. asked;
How can I make a model of a hydroelectric plant?
--------------
Here are some step-by-step directions and other resources that might be helpful for building a tiny hydroelectric generator.
http://www.instructables.com/id/Home-made-Hydro-Power-System/
http://www.instructables.com/id/How_To_Make_A_Tesla_Turbine_Greenest_Turbine/
http://www.picohydro.org.uk/
http://en.wikipedia.org/wiki/Microgeneration |
jacquie scott (Scott1164)
New member
Username: Scott1164
Post Number: 1
Registered: 6-2009
| | Posted on Wednesday, June 3, 2009 - 9:01 am: | |
Lecithin is an antioxidant that makes a good creamy emulsion. However, when lecithin is used to stabilize fats it goes rancid. what kind of preservative can I use to keep it from going rancid? |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1930
Registered: 12-2004
| | Posted on Wednesday, June 3, 2009 - 10:21 am: | |
Start by not letting any oxygen get to the fat to begin with.
Canning prevents air from getting to the fat.
Vitamins C and E are also good antioxidants. |
Aye Hsu Mon Aung (Unregistered Guest)
Unregistered guest
Posted From: 220.255.7.203
| | Posted on Saturday, July 25, 2009 - 11:45 am: | |
Dear Sir/Madam,
I am doing science project about tha-na-khar ( Limonia Acidissima ) from Rutaceae family. It is a tree from Myanmar. Elders believe that tha-na-khar has anti-bacteria properties and I am testing on that. Luvangetin is one of the chemical constituents in this. My question is DOES LUVANGETIN HAVE ANTI-BACTERIA PROPERTIES? and may I know the function of Luvangetin and the properties of Luvangetin?
Your Sincerely
student who loves science |
Simon Quellen Field (Sfield)
Senior Member
Username: Sfield
Post Number: 1933
Registered: 12-2004
| | Posted on Saturday, July 25, 2009 - 1:09 pm: | |
My friend Antony Williams runs a site called ChemSpider:
"http://www.chemspider.com/RecordView.aspx?rid=982054b6-14ca-4a6e-8998-98187e575f3d"
It is always a good place to start.
My own site for that molecule:
"http://sci-toys.com/scichem/jqp019/343582.html"
The molecule is biologically active, and is being studied to see if
it has effects on mammals:
"http://www.nextbio.com/b/search/ov/C09273?id=2908901&type=compound&synonym=C09273"
"http://www.novoseek.com/SearchAction.action?newSearch=1&query=%22Luvangetin%22[id%3Abioentity%3Achm_20042_none_1]&corpus=MEDLINE"
"http://toxnet.nlm.nih.gov/cgi-bin/sis/search/f?./temp/~FF9Gye:1"
"http://pubchem.ncbi.nlm.nih.gov/assay/assay.cgi?aid=330"
And on insects: "http://toxnet.nlm.nih.gov/cgi-bin/sis/search/f?./temp/~FF9Gye:2"
Other sources:
"http://cdb.ics.uci.edu/cgibin/ChemicalDetailWeb.psp?chemical_id=5246173"
The molecule is related to coumarin:
"http://en.wikipedia.org/wiki/Coumarin"
which plants produce because it is an appetite suppressant, and reduces
grazing. The anticoagulant warfarin is made from coumarin.
I see no studies relating this compound to antibiotic effects.
Yours may be the first. You may want to publish your results. |
evan allen (Unregistered Guest)
Unregistered guest
Posted From: 174.57.170.23
| | Posted on Saturday, October 3, 2009 - 9:27 pm: | |
how do you make a copper boat thats small for a science project? and it has to float. |
KIRAN (Muddy)
New member
Username: Muddy
Post Number: 1
Registered: 2-2010
| | Posted on Tuesday, February 16, 2010 - 10:20 am: | |
Hi.. i am doing a project that is given in SCIENCEBUDDIES..
http://www.sciencebuddies.org/science-fair-projects/project_ideas/Genom_p012.shtml?fave=no&isb=c2lkOjEsaWE6R2Vub20scDoyLHJpZDo1MjYwMzE5&from=TSW
It involves finding out evolutionary relationship between plants by CHLOROPLAST GENOME SEQUENCING.. Can you please tell me why only this particular sequence of primers are used for amplication of the RUBISCO part of the chloroplast genome???
Primer mix #1
Forward primer 5' ATGTCACCACAAACAGAAAC 3'
Reverse primer 5' CTTCACAAGCAGCTAGTTC 3'
Primer mix #2
Forward primer 5' ATGTCACCACAAACAGAAAC 3'
Reverse primer 5' TCCTTTTAGTAAAAGATTGGGCCGAG 3'
I have tried using PRIMER3 software to understand other kind of primers which could be obtained which amplifies Rubisco gene..
But why is only these primers used???
Will i get better amplification if i use different primer sequences???
Please answer as soon as possible..
Thank you.. |
KIRAN (Muddy)
New member
Username: Muddy
Post Number: 2
Registered: 2-2010
| | Posted on Tuesday, February 16, 2010 - 10:23 am: | |
Hi.. i am doing a project that is given in SCIENCEBUDDIES..
http://www.sciencebuddies.org/science-fair-projects/project_ideas/Genom_p012.shtml?fave=no&isb=c2lkOjEsaWE6R2Vub20scDoyLHJpZDo1MjYwMzE5&from=TSW
It involves finding out evolutionary relationship between plants by CHLOROPLAST GENOME SEQUENCING.. Can you please tell me why only this particular sequence of primers are used for amplication of the RUBISCO part of the chloroplast genome???
Primer mix #1
Forward primer 5' ATGTCACCACAAACAGAAAC 3'
Reverse primer 5' CTTCACAAGCAGCTAGTTC 3'
Primer mix #2
Forward primer 5' ATGTCACCACAAACAGAAAC 3'
Reverse primer 5' TCCTTTTAGTAAAAGATTGGGCCGAG 3'
I have tried using PRIMER3 software to understand other kind of primers which could be obtained which amplifies Rubisco gene..
But why is only these primers used???
Will i get better amplification if i use different primer sequences???
Please answer as soon as possible..
Thank you.. |
Jade Clifford (Unregistered Guest)
Unregistered guest
Posted From: 122.111.236.132
| | Posted on Tuesday, March 30, 2010 - 6:59 am: | |
Here's the assignment....please help me!
Working Scientifically: Problem Solving in Science
1. Design, construct and test a timing device, which sets off an alarm after 2
minutes, using readily available and inexpensive materials. Bring your device
to the workshop and be prepared to demonstrate its accuracy and ingenuity. |
Lance (Unregistered Guest)
Unregistered guest
Posted From: 173.89.174.32
| | Posted on Monday, May 17, 2010 - 1:30 pm: | |
I am new to this type of thing so any help would be greatly appreciated. Using a dc motor which is installed horizontally, how can I get the motor to drive a rod vertically? Links to parts or pictures would be awesome. Thank you in advance. |
Theresa Simmons (Theresa)
Senior Member
Username: Theresa
Post Number: 159
Registered: 1-2008
| | Posted on Monday, May 17, 2010 - 2:11 pm: | |
Gears are the usual solution.
But look also at how bicycle speedometers work.
A cable rotates in a flexible tube, and the orientation of
the two ends can be anything you like. |
Amanda Trefry (Atrefry000)
New member
Username: Atrefry000
Post Number: 1
Registered: 11-2010
| | Posted on Sunday, November 7, 2010 - 1:48 pm: | |
For my science fair project I have chosen to levitate a piece of ice between two magnets and pyrolytic graphite. I am having no luck levitating the ice. What am I doing wrong? Thank you! |
Theresa Simmons (Theresa)
Senior Member
Username: Theresa
Post Number: 165
Registered: 1-2008
| | Posted on Monday, November 8, 2010 - 10:47 am: | |
What made you think you could levitate ice?
Pyrolytic graphite will barely levitate all by itself, and it is the most
diamagnetic substance known. Ice is hardly diamagnetic at all. You would need
a Bitter solenoid to levitate ice, and that requires 6 megawatts of power
(enough to power 1,000 houses).
"http://en.wikipedia.org/wiki/Bitter_electromagnet"
"http://en.wikipedia.org/wiki/Magnetic_levitation"
"http://www.ru.nl/hfml/research/levitation/diamagnetic/bitter_solenoid/" |
A FRIEND (Unregistered Guest)
Unregistered guest
Posted From: 24.8.190.18
| | Posted on Wednesday, November 10, 2010 - 1:13 am: | |
Levitating ice seems to be at the edge of what you might be able to do with materials you could reasonably obtain. There are two experiments you may try to emulate: the magnet in mid air and the floating pyrolytic graphite.
As for the magnet in mid air experiment, it works because the magnet has a large magnetization. Since ice is only weakly diagmagnetic, you might think that this would put the kibosh on the attempt, but you could try dissolving a strongly paramagnetic salt, like gadolinium sulfate, in water and then freezing the water to ice. The nice thing about gadolinium salts is that they are colorless and highly paramagnetic. The bad thing is that gadolinium is hard to come by and somewhat toxic. When they give you an MRI, they inject you with about a gram of gadolinium, but it is complexed to a polydentate ligand which serves to protect you from free Gd3+ ion and even so some people with near zero kidney function can be made sick because they can't eliminate the constrast reagent fast enough. So you would want to be careful with it if you tried this. But hey, they used to say making a spoon out of Wood's metal and having an unsuspecting victim stir his tea with it was a great practical joke, before the flap about Hanna Montana charm bracelets being made of out cadmium .
Now, two problems with Gd2(SO4)3 in H2O: one is that when you freeze it, the ice will have a lower concentration of Gd2(SO4)3 than the liquid (recall that this is how zone refining works) and the other is that the overall material you get, even if you didn't dilute it by freezing, would be very weakly paramagnetic, and you don't see a whole lot of videos out there on the web where someone if levitating something even strongly paramagnetic (like terbium or warm gadolinium) or even something ferromagnetic (like a piece of steel or a Mond process ball) or even a weaker magnet than a neodymium-iron-boron one.
So if you wanted to go this route you may first want to try lifting weaker magnets than the N52 magnets sold on this website. Samarium-cobalt is the next step down, and you can get small samarium cobalt magnets lots of places. Then alnico: a chip off of a cheap horseshoe magnet would do. Or a small ferrite magnet which you can get at Home Depot.
To lift something like a piece of steel, which is ferromagnetic but not itself a permanent magnet is another large step up in difficulty. You might be able to do it with a setup that had a large (maybe 1 inch in size, but not bigger -- the ratio or danger to fun gets high after this) neodymium magnet on top and a superconducting YBCO disk underneath. The trouble with this is that although the magnet and the YBCO disk aren't too expensive, you have to keep supplying liquid nitrogen to keep the YBCO superconducting, so it costs something (call your local welding supply company to find out how much) every time you want to do the experiment.
To lift something which is merely paramagnetic and not ferromagnetic is another step up in difficulty again, I don't know whether the arrangement of the previous paragraph could do it. But even to lift up something with magnet+YBCO that wasn't itself a neodymium magnet would be a feat beyond what students ordinarily achieve in these kinds of projects.
The other possibility is like the floating pyrolytic graphite. Again you have the disadvantage that water is not as strongly diamagnetic as graphite, and also if you insist on working with ice, it means you have the additional constraint of keeping the whole apparatus cold while it is operational. Bismuth should be slighty easier to float than water or ice because its ratio of magnetic susceptibility to density is a little larger. Also you could try the experiment at room temperature in this case. I can envision geometries where you might be able to float a really small flake of bismuth, but not with the magnets that Simon sells. The best you could end up with would be possibly a flake of bismuth that is so small as to be hard to see floating so close to a magnet that it is hard to detect the separation. You might even be able to do ice or a drop of water like this but the result would be even less impressive. The first stable levitation was obtained with bismuth and a powerful (but not million-dollar kind of powerful) electromagnet, if I recall correctly. |
swami238 (Unregistered Guest)
Unregistered guest
Posted From: 122.169.0.37
| | Posted on Tuesday, November 23, 2010 - 2:40 am: | |
HI
I am a reseatch student. For one of my project I have developed a compound called " 2-(4-Aminophenyl)-5-aminobenzimidazole CAS No. 7621-86-5.
I am not able to proceed with my project as I could analyse the product for its purity and impurity profile.
Could any one from the science community could help me by giving information on how to test the product in HPLC or GC. |
A FIREND (Unregistered Guest)
Unregistered guest
Posted From: 24.8.190.18
| | Posted on Friday, December 10, 2010 - 11:28 pm: | |
I wanted to post this to the thread "Trouble with pyrolytic graphite" in the Forum "I am having trouble building one of the toys", but the forum software wouldn't let me so after taking the trouble to compose this long message I am posting it here.
This is an interesting old thread which contains inaccuracies that have persisted for years, so I just can't resist the opportunity to clear them up.
In his post of 4/30/03, Simon Quellen Field said:
"The magnetic field is strongest at the centers of the poles."
Actually this isn't true. For a rectangular magnet, the field is strongest at the edges. See http://www.youtube.com/watch?v=tR_8f0DYK5s from about 1:00 to 1:30 for a measurement with a gaussmeter.
SQF 5/10/03:
"I think you will find that the pyrolytic graphite is
not only much easier to work with, but will levitate
about three times higher."
(In comparison to randomly oriented graphite.)
This is wrong for a couple of reasons: Three times the force doesn't mean three times higher because the magnetic force doesn't vary linearly with height but instead drops off much more rapidly.
Also, what makes you think that the orientation of pg is more favorable than random orientation for this experiment? Of course, it's hard to compare directly becaue random graphite can have impurities that make it much less diamagnetic, or even paramagnetic as has been noted in this discussion. There is a way to test this assumption, though...
SQF 6/26/05:
"Magnetic repulsion falls off with
the third power of distance. Diamagnetic repulsion falls off with the
fourth power of distance."
At large distances between magnets, magnetic force falls off with the fourth power of distance. At closer separation, the relationship between force and distance is more complicated than a power law except for mathematically simple geometries such as spherical magnets.
Diamagnetic repulsion falls off as the fourth power of distance only for the case where you have a large thick diamagnet. This happens because the magnet sees a weak reflection of itself and repels as the fourth power of distance. If the diamagnet is thin, like the pg you can reasonably buy, the repulsion goes as the fifth power of distance because the reflection the magnet sees from the back side almost cancels out the reflection from the front. If the diamagnet is small, the repulsion goes as the seventh power of distance, just like a dipole-induced dipole force.
SQF 5/29/07:
"As magnets get farther away from one another, the field does begin to
look like a sphere. Now we get another effect happening, that will
show you why we get the fourth power.
You can think of a diamagnet as a mirror for a magnet. The magnet acts
as if it is seeing its mirror image in the diamagnet. Now you can see
that as you double the distance between the magnet and the mirror, you
quadruple the distance between the magnet and its mirror image. So instead
of a square law, we get a square law times a square law, hence the fourth
power."
The far field of a dipole still looks like the near field of an ideal dipole. To have a magnetic field that looks like a sphere a large distances, you would need a magnetic monopole. Of course, these can be purchased from the same vendors that sell fine bridges
The fallacy in the second paragraph above can be best analyzed thus: If force varies with r2, then we can say that F = k•r2. Then if the distance to the image changes twice as fast as our distance to the mirror, we can say the r = 2•d, so F = k•(d/2)2 = (k/4)•d2, and still varies with d2.
Diego Assencio 10/23/08 said:
"what is the value of M inside the magnet?"
The definition of Br is that Br = m0•M.
ameya chandekar 12/6/10 said:
"CAN WE INCREASED THE LEVITATION HEIGHT OF THE PLATE BY INCREASING THE MAGNETIC INTENSITY OF THE MAGNET"
You may not be able to buy magnets stronger than N53, but you can at least in principle change some of the geometric factors in your favor. As the magnets grow bigger, the magnetic field that lifts the pg also gets bigger, so buying bigger magnets could help you lift higher. However, big neodymium magnets are really dangerous. Examples of the potential for injury and actual injury can be found on YouTube, just search for "neodymium fingers" -- you have to be ³ 18 to view.
Also, if the manufacturer were kind enough to leave the edges of the cubes as sharp as possible rather than rounding them off as they do, some of the most important material for lifting woudln't be destroyed, although it would make the magnets more fragile. |
A FRIEND (Unregistered Guest)
Unregistered guest
Posted From: 24.8.190.18
| | Posted on Saturday, December 11, 2010 - 10:30 am: | |
Amazing that I couldn't even spell my own name in the above post. There are even more inaccuracies. In particular, for some reason I find myself saying "varies with" when I should be saying "varies inversely with" throughout the post. I offer the following corrections:
In my response to SQF's post of 5/10/03, I said:
"This is wrong for a couple of reasons: Three times the force doesn't mean three times higher because the magnetic force doesn't vary linearly with height but instead drops off much more rapidly."
I should have said:
"This is wrong for a couple of reasons: Three times the force doesn't mean three times higher because the magnetic force doesn't vary inversely with height but instead drops off much more rapidly."
In my response to SQF 6/26/05, I said:
"This happens because the magnet sees a weak reflection of itself and repels as the fourth power of distance. If the diamagnet is thin, like the pg you can reasonably buy, the repulsion goes as the fifth power of distance because the reflection the magnet sees from the back side almost cancels out the reflection from the front. If the diamagnet is small, the repulsion goes as the seventh power of distance, just like a dipole-induced dipole force."
I should have said:
"This happens because the magnet sees a weak reflection of itself and repels inversely as the fourth power of distance. If the diamagnet is thin, like the pg you can reasonably buy, the repulsion goes inversely as the fifth power of distance because the reflection the magnet sees from the back side almost cancels out the reflection from the front. If the diamagnet is small, the repulsion goes inversely as the seventh power of distance, just like a dipole-induced dipole force.
In my response to SQF 5/29/07 I said:
"The fallacy in the second paragraph above can be best analyzed thus: If force varies with r2, then we can say that F = k•r2. Then if the distance to the image changes twice as fast as our distance to the mirror, we can say the r = 2•d, so F = k•(d/2)2 = (k/4)•d2, and still varies with d2."
I should have said:
"The fallacy in the second paragraph above can be best analyzed thus: If force varies inversely with r2, then we can say that F = k/r2. Then if the distance to the image changes twice as fast as our distance to the mirror, we can say the r = 2•d, so F = k/(d/2)2 = (4k)/d2, and still varies inversely with d2." |
