I need help with my Science Fair project Science Toys | Science Blog | Log Out | Topics | Search
My Toys | Energy | Moderators | Register | Edit Profile

Scitoys Message Board » I need help with my Science Fair project  

  Thread Last Poster Posts Pages Last Post
Is it possible to magnetically levitate bacteria?Michaelliang 37 5-28-08  3:57 am
Things you just want to knowTheresa Simmons 61 2-4-10  7:46 pm
Anybody know about making motors for model cars from scratch?Syed Haider Abbas 12-30-07  11:45 am
My son 10 wants to build his own small solar cell Syed Haider Abbas 12 1-1-08  11:00 am
Wind tunnel (aerodynamics)Simon Quellen Field 10-21-05  9:29 am
I need help to build a portable power supplyDEXTER bernardo 5-9-10  9:15 pm
Magnetic Linear AcceleratorJohn Mathis 4-4-07  7:33 pm
Magnetic Linear AcceleratorAnshul Shah 19 7-12-10  4:36 am
URGENT- I don't know anyone else to askJohn Kondo 10-7-08  7:07 pm
Floating magnetMatt 20 10-28-09  6:45 pm
How fast or where else can i find the mk484-1 am radio ic?Anonymous8-28-05  10:03 am
What are the ratios of field's metalAnotherAnonymous7-21-05  6:01 pm
Need help with a wind turbineSimon Quellen Field2-16-03  1:05 pm
Tank circuitMark Ashmeade1-15-04  9:05 pm
RC Robotpaoie 10 7-5-07  3:25 am
Radio transimitter (am or fm)Jacob Morrison 27 10-22-08  2:12 am
Magnet does not floatally 12 11-9-05  3:48 am
I need a way to test the strength of a given wallAnonymous12-1-03  6:49 pm
Can the gauss rifle be used for target practice?Simon Quellen Field3-28-03  10:59 am
LaserSimon Quellen Field 13 1-9-08  12:31 pm
In the laser project....Simon Quellen Field 20 1-9-08  9:30 am
Solar Car?walker josey 10-3-07  5:51 pm
I need help building a liquid fuelled jet engine for a RC jetRohan 11 3-15-08  1:45 pm
Building a computer controlled transmitter Simon Quellen Field6-7-03  2:59 pm
Audio amplifierRandy 24 7-17-07  5:16 pm
Film can cannonKasper Emil Feld 15 1-18-08  3:37 am
Need help on energy a projectken9-21-03  5:29 am
Is there a way to make helium at home? 4dan56 52 1-2-11  1:25 pm
URGENT - MR FIELDS - PERPETUAL MOTION!!!WHOMEWORRY? 16 2-13-09  8:56 am
Ordering from catalogAbiy 11-22-05  10:35 pm
Himeenu10-29-03  10:04 am
Aerodynamics testingSimon Quellen Field10-28-03  7:42 pm
Insulated and enamel wireSimon Quellen Field11-12-03  12:55 am
Solar cell questionsscott 21 7-20-08  2:29 pm
I need help! on this Project!Simon Quellen Field11-18-03  4:51 pm
Sound waves projectash 10 1-13-09  3:56 pm
Project similar to computer controlled transmitterSimon Quellen Field13 6-21-04  9:35 am
Laser transmitter partsSimon Quellen Field12-18-03  6:33 pm
Help Van de Graaff generator Theresa Simmons 57 4-17-10  12:19 pm
Laser project transmitter connectionsSimon Quellen Field 2-26-05  11:17 pm
Timing Devicemnado 2-4-06  6:15 pm
Timing Device IIAnonymous7-24-05  1:32 am
Curie point and magnet (wheel)Fabrice2-17-04  7:36 am
Controlling the Transmitter from VBMichael Fincham1-5-05  4:28 am
GalliumAnne Archibald 33 1-11-10  8:53 pm
RC car run from the computer.Weebl5-24-05  11:55 pm
Time for Shipping?Simon Quellen Field3-12-04  9:03 pm
Urgent radio receiver helpJames Stanley 7-6-07  1:51 am
Radio receptionAnonymous9-12-05  3:25 am
Help meI. Dimov 16 8-21-06  5:07 pm
Gauss Rifle researchChris Kozaczynski 3-26-08  10:26 pm
Moped turn signalsDavid S4-4-04  10:36 pm
Aluminum iodine reaction ?I. Dimov 12-31-05  5:45 am
Solarscope....................6-13-09  7:10 am
Tesla watchesKirsty Stewart 10 5-26-10  11:03 am
Simple Radio Control circuit for homemade model carPatrick 5-16-08  6:21 pm
Gauss accelerator and Potential EnergyAMauboussin 2-28-07  7:43 pm
Magnetic ShieldingSimon Quellen Field6-7-04  11:30 am
Rewireing a transformer to make it strongerJohn P Becich 5-1-05  9:53 am
Homemade arc welderr33p3r 13 5-14-10  5:07 pm
Whats Wrong With My Color Sony TV???Red Dragon 18 6-28-10  4:09 pm
Computer controlled transmitterSimon Quellen Field7-29-04  1:25 pm
Science fair researchAimee W.8-26-04  6:39 pm
Carbon RodsjOSH 13 12-25-05  11:45 pm
Gauss RifleAMauboussin 2-28-07  7:45 pm
Inviting Entries to Electronic Design Contest to win cash $100Anonymous9-15-04  12:24 am
Is there a way to measure the distance a laser pointer is pointed a...Anonymous10 9-14-05  5:50 pm
Great Fun!Simon Quellen Field10-2-04  12:09 pm
Hydrogen bomb...adviceSimon Quellen Field10-5-04  9:44 pm
Van De Graff generator Theresa Simmons 44 1-3-10  11:54 am
Blocking MagnetismTheresa Simmons 16 2-13-10  2:48 pm
Microbial fuel cellsSimon Quellen Field10-21-04  10:05 am
Electrostatic Generatorsmike 12-15-06  6:52 am
Remote control jammer.Chaos Collier 1-23-06  4:41 pm
The Computer Controlled TransmitterAnonymous12-1-04  6:41 pm
ElectrolysisJordan Beland 31 2-16-07  11:09 pm
Please help with Remot ControlAnonymous4-13-05  4:36 am
A Transmitter chipSimon Quellen Field 1-5-05  4:56 pm
Breadboard QuestionSimon Quellen Field 1-2-05  11:18 pm
Cristal Radio ?!Theresa Simmons 16 1-10-09  1:20 pm
High heat resistant glovesAnonymous8-26-05  10:03 am
Gauss Riflelysdexia3-5-05  9:16 pm
Magnets affect bb trajectory?Simon Quellen Field 1-10-05  7:13 pm
Where can I get some Diamagnetic Graphite for levitation?Simon Quellen Field 1-26-06  6:16 pm
Quick QuestionSimon Quellen Field 4-12-05  9:22 pm
Gauss Rifle TheoryJason Jimenez 11 11-13-10  12:01 pm
Who make or invent "a magnet in a mid-air"?Simon Quellen Field 1-13-05  12:25 pm
Propulsion Idea for a Modelled Caryoyo 20 10-27-09  8:58 pm
Hydrogen fuel cellmarx 11 5-14-08  4:23 am
PendulumSimon Quellen Field 1-15-05  7:59 pm
Force-using SciToySimon Quellen Field 6-15-05  10:05 am
Son's Science Fair AcceleratorChris Kozaczynski 4-1-08  7:30 pm
FM transmitter (big problem!)Christopher DiPaola 1-27-08  7:36 am
AC / DCHCARRILLO 1-20-10  1:15 pm
Bubbles and heatSimon Quellen Field 7-27-05  5:30 pm
The BatteryDomenic Bruno 12-30-05  12:14 pm
Help on researchSimon Quellen Field 2-9-05  9:59 pm
How to build a small heat gun?Simon Quellen Field 2-12-05  2:59 pm
Thermocouples: ThermocellRandy G. 12-30-06  4:46 pm
Increasing the effects of diamagnetic levitationSimon Quellen Field 11 10-19-09  9:16 pm
Diamagnetic Levitation using Graphite from PencilsSimon Quellen Field 11-29-07  12:14 pm
Converting Elastic Energy Into Electrical EnergyAnonymous7-30-05  7:02 pm
Electromagnetic Spark PlugSyed Haider Abbas 1-9-08  12:22 pm
Gauss rifle/perpetual motionAnonymous4-12-05  11:14 am
Shippingmarcus quintilian 9-23-07  7:47 pm
Old laser communicator plansDrew2-27-05  3:45 pm
Storing HydrogenSimon Quellen Field 12 7-12-07  2:03 pm
I need help with windAnotherAnonymous5-2-05  3:00 pm
URGENT!!!!!!greg koz 10-12-06  4:47 pm
Urgent! need help with bibilography for school projectSimon Quellen Field 4-20-05  11:27 pm
Help with Hydrogen Fuel CellSimon Quellen Field 4-22-05  9:31 am
Catchy NameAnonymous3-10-05  1:20 am
FM TransmitterAnonymous3-9-05  6:46 pm
Sound device that makes noise to warn people.Marcus Shaw 9-25-06  5:50 pm
ChromatographyAshley Meritt3-16-05  8:21 am
Dynomiteinventer8-7-05  4:09 pm
Blow- upRick3-16-05  12:35 pm
ChromatographyPhilip 8-11-06  1:51 pm
Need help with mobile phone reception!!!!!! PLZ Help!!!daaaa5-14-05  1:12 pm
Hydrogen Fuel Cell QuestionsArthur Yip4-10-05  8:27 pm
Attaching a speaker to three penny radioSimon Quellen Field 4-15-05  8:01 am
Piezoelectric crystalsSimon Quellen Field 4-16-05  8:44 am
Neon detonatorjaygo bloom3-27-05  1:33 pm
Hi, Someone HELP!!!!weebl5-24-05  11:35 pm
Where is simon?Arthur Yip4-10-05  8:39 pm
Magnet levitationjoshua4-9-05  11:00 pm
Magnet levitationjoshua4-9-05  11:02 pm
Measuring currentMadScientist 4-24-05  10:56 pm
Recommended reading for a NewbieTommy 4-18-05  1:58 pm
Why the angst from lysdexia towards Simon?Anonymous4-18-05  2:02 pm
Salpeter rocketSimon Quellen Field 4-29-05  9:49 am
I need to know the most combustable fuelgreg koz 10 12-28-06  9:28 pm
Short Term Memory Test - 7th Grade ProjectJoanna Walker 4-20-05  7:11 pm
Van de Graaf generator MadScientist 14 4-27-05  6:56 pm
Success!Arthur Yip 4-23-05  4:15 pm
Ball Bearing Rollar coasterJustin11 4-25-05  1:45 pm
Hanging ball toyMadScientist 4-26-05  7:12 pm
Interesting adaptations and problems with the 'Free Energy' Flashli...Simon Quellen Field 4-28-05  11:50 pm
More Powerful Gauss RifleSimon Quellen Field 5-1-05  10:42 pm
Separating LyeFlowMast 20 6-18-07  12:46 pm
Help!Anonymous7-26-05  7:55 pm
ElectrostaticJim 5-3-05  11:00 pm
Electric lighterSimon Quellen Field 5-25-05  9:14 am
Bookhttp://www.muchila.c9-23-05  7:17 pm
Lcd helpstupoop5-18-05  5:05 pm
How to measure mega-gauss-oersted?Anonynous 11-6-08  9:47 pm
Uses for cooling fan?Rohan 7-10-08  10:27 am
Shocks with the ignitersAnonymous15 7-30-05  7:42 pm
Development platform uses old computer power supplyAnonymous5-10-05  3:24 pm
Projects using items in your homeStojance 4-3-06  1:18 pm
Take apart a laser pointerHank 3-9-08  3:36 pm
? about electric lighterSimon Quellen Field 5-25-05  9:18 am
AM Transmitter and Walkie TalkieSimon Quellen Field 5-13-05  12:35 am
I need a Balanced Equation for a Electrolysis experimentmazx 5-15-05  4:35 pm
Please can you help meDennis 10-24-08  1:00 am
Resistors from radiosWeebl10 5-24-05  11:12 pm
ResistorsSimon Quellen Field 5-18-05  4:05 pm
Soldering?Evan Holdstock 5-19-05  6:54 pm
1 watt amp.Simon Quellen Field 5-20-05  4:42 pm
I need helpisc_grd@hotmail.com 5-22-05  3:05 am
Parellel and Series of capacitorsArthur Yip 5-27-05  10:12 pm
Look!!!come on!Abe Y. 11-14-05  5:05 pm
12V to 16V ConverterManoj V 12 9-20-06  2:32 am
Help Please!***USER PATROL****5-29-05  2:10 am
Please Read This! Urgent!Anonymous5-29-05  2:05 am
PLEASE!Anonymous5-29-05  2:07 am
Flame effect for a witch broomAnonymous6-12-05  12:41 pm
Liquid nitrogen & copper spherenotaplaya4u 8-11-08  7:16 pm
The Fresnel lensSimon Quellen Field 6-19-05  1:05 pm
Infer Red Beams or Radio Wavesarik hartsaugh 6-21-05  3:33 pm
A Robot?Marat Orazov 7-17-05  3:13 am
Amateur Radio Licensenewbie 8-14-07  7:20 pm
Pleez help me! Anonymous9-16-05  4:14 pm
2 coiled motorHendrix006-29-05  1:07 pm
Resistor color codemoisdaniel 7-11-05  11:56 am
Measuring electromagnetic drag on copperSimon Quellen Field 16 7-21-05  9:55 am
Help with receiving 20MHz Oscillator SignalSimon Quellen Field 7-8-05  12:11 am
I need an ideaTrevor 7-7-05  12:26 pm
Is it possible and what is needed?Simon Quellen Field 20 7-17-05  12:56 am
Ice and acids....Marat Orazov 8-15-05  12:04 am
Mini-hydroelectric generator Theresa Simmons 15 9-11-09  10:36 am
Franklin's Bells (electrostatic bells)hell 11-8-08  12:26 pm
Spell CheckerSimon Quellen Field 7-21-05  9:57 am
AM Voice Transmitter: Help!!Simon Quellen Field 7-24-05  6:07 pm
NitrogenSimon Quellen Field 14 8-8-05  12:49 pm
Solar powered battery chargersachron3 3-21-08  12:50 pm
I need help in building a small model flying platform.Anonymous8-10-05  10:50 pm
DRY ICE COOLING (-78'C) ?Theresa Simmons 20 1-23-10  10:48 am
Connecting LED'sMadScientist 5-4-06  7:45 pm
Prisms & lasers.Simon Quellen Field 8-14-05  11:03 pm
Model car with electric motorAnonymous9-10-05  2:03 pm
Flux and powerSimon Quellen Field 8-17-05  10:48 am
British Thermal UnitsArcygenical8-22-05  3:23 pm
How to pick locks without a pick.Corrupt 21 5-15-10  10:46 pm
!!!!!!!!!!!!!!!!!!!!!!!!!STATIC!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!fofo 8-1-07  7:41 am
WOULD THIS WORK IN SPACEMarat Orazov 8-25-05  8:34 pm
HelpKiley Faubion 9-3-05  8:21 pm
Magnesium URGENTSimon Quellen Field 8-30-05  9:27 am
Scanner PhotosSimon Quellen Field 9-6-05  10:21 am
How much air does a mouse need to breath?Tamara DePue 16 10-7-05  7:09 pm
How to make padlock shimsMichael 1-7-07  10:41 pm
Monowheel? science fair project or disaster waiting to happen Anonymous9-15-05  3:58 pm
Hydrogen fuel cell car *urgent*marx 42 5-15-08  3:10 am
I'm looking for a kind of shield that diffuses light along one axis...Paul David 9-14-05  6:39 pm
Two questions...Simon Quellen Field 9-18-05  12:20 pm
HELP NEEDED!!!!!!FAST.Deepak Jose 9-15-05  11:52 am
A Compelete Electronic Resource Centre - Circuits - Tutorials - 805...Anonymous9-16-05  1:15 pm
12V isnt always 12VMadScientist 25 10-22-05  3:11 pm
Walkie talkie receiverjustine aquino 12-17-05  6:03 pm
Help with an elctrical circuit to control a motorMadScientist 9-26-05  5:16 pm
Help with an elctrical circuit to control a motorThrasher9-20-05  8:34 pm
My vand de graff generatothrasher 10-5-05  5:52 pm
Questions about metals in catalogI. Dimov 1-1-06  3:24 am
ScienceKasper Emil Feld 17 12-10-07  8:11 am
Curie Point EngineMadScientist 10-11-05  10:17 pm
My first projectLee Joon Hon Alvin 10-17-05  7:47 am
Cristal Radio - FormulasSimon Quellen Field 10-15-05  11:34 am
Liner particle acceleratorAlexander N Roberts 10-21-05  6:50 pm
Remote ignition of the film can cannon.Simon Quellen Field 10-24-05  10:23 am
Cloud ChamberSSeed 10-25-05  2:10 pm
SearchlightAnotherAnonymous 11-9-05  6:36 am
URGENT!Michael F. Turpen 12-8-05  1:44 pm
Help!Anynimous 11-14-05  9:33 am
About 1.2 kW Nexa Fuel Cell Power Module Edgar 11-16-05  11:28 am
I ned help on my new science fair projectSimon Quellen Field 11-18-05  10:28 am
HelpDmitriydemon 11-23-05  1:47 am
Stirling engine designMatthew Quinney 11-23-05  10:08 am
Envelopes and Blue LightI. Dimov 1-8-06  8:21 am
Music Test WebsiteKellen Mrkva 12-5-05  12:36 pm
Electromagnetic gauss rifle.Kevin K 12-5-05  5:14 pm
Infrared tracking...Azo 12-23-05  10:10 am
Is it possible to make a really tiny 2-way radio and with some adva...Jonathan 12-17-05  10:15 am
MY HYDRO-ELECTRIC GENERATOR ISNT WORKING HHHHHEEEELLLPPP!!!!!!!ASAP...Simon Quellen Field 12-18-05  6:45 pm
Biogasoline?Michael 12 8-3-07  1:12 am
Van De Graaff GeneratorSimon Quellen Field 12-23-05  6:42 pm
Homemade geiger counterTravis Babcock 12-25-05  11:46 am
RC Car Conversionstober 10-1-08  1:45 pm
Photo capacitorSimon Quellen Field 2-9-06  10:18 am
12mm magnets with "magnet in mid"Simon Quellen Field 1-6-06  9:41 am
Generator of a water pump motorSimon Quellen Field 1-9-06  11:36 am
Van de Graaff generator and Electric FieldZack 1-24-06  6:11 pm
Curie Heat Engine, but only One MagnetSamuel Edward Lee Mc1-9-06  7:34 pm
Small water pumpSimon Quellen Field 1-10-06  3:45 pm
Heatable ferromagnetic materialsSamuel Edward Lee Mc1-10-06  6:01 pm
"Ultra-simple Electric Generator"ryan sullivan 2-14-09  10:02 am
To control a Radio Control(r/c) Car though MobileAlexander N Roberts 1-23-06  5:04 pm
I really need help. I am trying to build a remote control sweeping ...Simon Quellen Field 1-30-06  11:43 am
Van de Graaff helpSimon Quellen Field 3-5-06  1:22 pm
Advanced hydrolysis deviceSimon Quellen Field 2-3-06  12:32 pm
Build Walton Cockroft voltage multiplierDagwood 10 12-18-06  4:39 pm
Need help understanding some forces in the M.L.A.Simon Quellen Field 3-14-07  12:05 am
Spark plug pulsed Joshua Martin 2-12-06  3:05 pm
Dc motorSimon Quellen Field 2-7-06  9:32 am
Ac/Dc AdaptorSimon Quellen Field 2-7-06  9:33 am
Possible to make a compressor?Simon Quellen Field 2-14-06  9:54 am
Electrolysis questionArthur Yip 12 2-12-06  3:20 am
What's wrong with my plastic hydrogen bombmatthew devries 2-22-07  5:21 pm
Vacuum pump modefication helpPaul Simon 2-12-06  10:01 am
BatterySimon Quellen Field 2-13-06  10:25 am
Copper platingmnado 2-13-06  4:51 am
Soldering ironsJoshua Martin 13 3-5-06  8:08 pm
Diffrent oscillator questionsSimon Quellen Field 2-13-06  10:31 am
Preventing/reducing carbon graphite electrodes from being used upPaul Simon 2-14-06  5:32 pm
Nuclear/reactor grade pyrolytic graphite impurities?meredith lamb 2-23-06  11:59 pm
Does levitating PG generate a EMF when moving?meredith lamb 2-20-06  1:38 am
Livestock feederJoshua Martin 2-26-06  5:15 pm
Thermoelectric cooling Randy G. 6-21-07  6:03 pm
Steel Balls for Gauss RifleAlexander N Roberts 3-1-06  3:42 pm
Question about ProductsAlexander N Roberts 3-1-06  4:34 pm
Hydrogen Fuel CellTheresa Simmons 22 4-7-09  7:16 pm
Weight QuestionChris Collins 3-2-06  9:39 pm
BatteryChris Collins 3-5-06  11:44 am
Magnetic Ring LauncherMichael White 3-19-06  1:47 pm
Motor timer?Paul Simon 3-22-06  2:25 pm
EasyBrahimMansaray 3-26-06  3:31 pm
DC motor helpMadScientist 18 4-1-06  11:52 pm
VDG GeneratorSimon Quellen Field 3-30-06  11:51 am
Neodymium Disc magnetsmarisol lopez 4-10-06  10:56 am
Is this microfone possible to build??? Anyone!!! (especialy Simon)...Alessandro 4-17-06  6:35 am
Ice Cube CurrentMadScientist 10 4-22-06  12:06 pm
I am wonderin'?Arthur Yip 12 6-4-06  12:10 am
Switch help (please)MadScientist 15 5-2-06  8:26 pm
Infrared heat lamp and a dimmer switch. Will it work?Paul Simon 4-28-06  10:57 pm
What should I use this for... I. Dimov 5-17-06  1:31 pm
Electrolight capicitor bomb?MadScientist 5-12-06  10:12 pm
Third railBrahimMansaray 5-9-06  8:07 pm
AC Generator variablesJonathan Grova 7-1-06  1:56 pm
HV CAP FOR MY TESLA COILM F 5-19-06  12:19 pm
Help with solar projectSimon Quellen Field 5-18-06  9:36 am
Marble lanchermeip 12-8-07  9:52 pm
CoilAlex Roberts 5-21-06  7:12 pm
What is this computer for !????????????Stojance 5-23-06  6:30 am
Attention Tesla Coil Enthusiests Sp?Joshua Martin 5-29-06  2:52 am
Tesla Coil questionM F 5-27-06  2:16 pm
Bone Conduction (Sound Waves)Stojance 6-1-06  7:59 am
Wireless HeadphonesStojance 6-2-06  5:57 am
Piezoelectric Earphone subSimon Quellen Field 29 10-10-07  4:02 pm
I need help with my next BIG project. I don't know what to do...Simon Quellen Field 6-18-06  1:59 pm
Electronicsphysics boy 10 9-11-06  8:51 pm
Magnetic Linear Accelerator!Craig Stone 6-19-06  12:57 pm
Cool an electromagnetnormburns 20 10-8-10  6:37 pm
Leiden jarSimon Quellen Field 10 9-14-07  9:13 pm
Diode resistanceEvan Gareau 14 9-22-06  9:26 am
Hovercraft equationsPatrick 13 2-22-08  4:32 am
Tesla coil UV helpRobertoK 1-23-07  1:49 am
Liquid nitrogen questionKasper Emil Feld 20 12-10-07  6:59 am
One more try...Aaron K. Moore 19 7-25-06  11:48 pm
Incubator for eggsJoshua Martin 11 7-27-06  2:14 pm
Flashing bulbsphysics boy 16 8-10-06  2:28 pm
Electron emmiterAaron K. Moore 7-26-06  9:32 pm
A magnet questionAlex Roberts 7-27-06  9:17 pm
Electronic helpphysics boy 3-8-07  4:05 am
Computer Controlled Transmitter (slight modification)Simon Quellen Field 8-6-06  11:37 pm
Recharge a battery off a solar cellDaniel Gil 21 3-22-08  6:33 pm
Rail GunSimon Quellen Field 8-16-06  4:31 pm
The capture of hydrogenHotairballonist 11 11-20-06  5:06 pm
Is there a way to see an infrared laser?reid ballard 12-2-06  9:08 pm
Interesting Phenomenonphysics boy 8-22-06  10:33 am
Calculate eddy current repel forceSimon Quellen Field 11 8-31-06  10:21 am
Atoms???James 9-11-06  8:24 pm
Trouble with the Coilguns.d. 11-8-10  2:20 am
Mass moment of inertiaTrev M. 10 10-4-07  10:57 pm
Copper wireSimon Quellen Field 9-17-06  1:41 pm
Coil gunAlex Roberts 9-19-06  2:57 pm
Gallium metalSimon Quellen Field 9-18-06  10:37 am
Solarpowered morsecode transmitter; How to store+play beeps? EEPROM...Patrick 5-22-08  9:05 am
The crystal radioSimon Quellen Field 1-28-08  9:15 am
Help on Electricity/Water ProjectSimon Quellen Field 4-11-07  12:21 am
Water Purification ProjectWalter Marlin 4-6-07  3:01 am
Help my site!Red Dragon 3-2-10  1:03 pm
10 minute radioGeorge Cakiades 10-12-06  7:52 pm
RUBBER BAND POWERED CAR HELPMaryinOhio 31 5-14-10  12:00 am
Hydrogen Bombmatthew devries 10-16-06  5:01 pm
Electromagnetthank you 12-2-10  11:43 pm
Other data transmission with a laser?Simon Quellen Field 10-18-06  10:32 am
MK484 tuning capacitorSimon Quellen Field 11-7-06  10:38 am
My Science Fair Projectmatthew devries 11-7-06  6:06 pm
Using the AM Transmitter in a project??bengalfan2011 11-10-06  2:51 pm
A battery made of something different...Lee Joon Hon Alvin 12-31-06  7:52 am
Ways to measure radio strengthJimS 12-8-09  9:02 am
Levitating with your fingertips?James 11-19-06  11:17 am
Hydrogen Bombmatthew devries 11-19-06  10:55 am
A great hot air ballon design Hotairballonist 11-23-06  9:57 pm
Faraday cage working partiallySimon Quellen Field 1-28-07  7:31 pm
Building a Hydrogen Electrolyser/Fuel Cell - Cheap!ffischer_76 3-31-07  12:09 pm
IMPORTANTmatthew devries 11-25-06  5:18 pm
Magnetic Linear Accelerator - Hypothesis for SciFair experimentjames cross 12-11-06  11:02 pm
Need To know ASAPJCook63123 11-10-07  11:43 am
EquationCody 12-25-06  11:24 pm
GravitySimon Quellen Field 12-29-06  1:29 pm
Plaster side effect?I. Dimov 12-29-06  4:27 am
RC moduleI. Dimov 12-28-06  11:58 am
Home turbine?Randy G. 13 1-12-07  2:47 pm
ElectromagnetSimon Quellen Field 1-10-07  9:41 am
How many turns to make a good transformer for a spark?SuperNerd 4-11-07  5:37 pm
Laptop lcdMichael 1-29-07  8:38 am
Transistor differenceKiley Faubion 2-12-07  12:34 am
Polyester Resin Isn't See-throughmatthew devries 2-14-07  2:27 pm
Hydrogen Bombmatthew devries 2-17-07  1:30 pm
Hydrogen separationRoberto K 2-19-07  2:38 am
Questions about electrolysisRandy G. 2-24-07  8:40 pm
Aspirinsara gilliam 2-22-07  4:44 pm
Magnetic CradelPatrick 8-20-10  9:36 pm
Gauss Rifle Energy MeasurementsBob_g 2-23-07  5:17 pm
SERIOUS VAN DE GRAAF GENERATOR PROBLEMSbazuka 13 11-6-07  10:14 pm
Solar iPod chargerGuest 12 4-15-08  5:16 pm
Properties that effect radio wave "conductivity"AndrewD 4-7-07  7:59 pm
VAN DE GRAAF ISSUES!!!Sam Carlberg 1-13-09  7:48 pm
HOW MANY AMPS WILL THIS DRAW???????Michael 3-15-07  3:35 pm
Electrical Circuits?Ray Lyford 3-22-07  12:18 am
Inportant Electric QuestionBrett 13 1-8-08  3:59 pm
Help! Voltage boosing.Justin 5-29-07  5:26 pm
Urgent Model Fractioning ColumnI. Dimov 4-1-07  7:08 am
Radio Transmitter Question!!!Simon Quellen Field 4-12-07  11:15 am
1MHz or 16MHz oscilatorHarris Sh 4-26-07  12:26 pm
PhonographMara 3-29-08  2:00 pm
Slingshot car URGENT!Justin 5-30-07  9:50 pm
Potato Cannon Matters i.e. I need helpJoshua Martin 4-28-07  2:05 am
Convert Salt Water to Pure drinking water using what?Michael 8-13-07  1:23 pm
Reading 400V coil gun helpJustin 9-1-07  12:16 pm
Rail GunJustin 6-4-07  4:55 pm
Max current calculations.Justin 6-8-07  11:16 pm
Igniter spark energy questionSimon Quellen Field 6-29-07  9:44 am
Thermal electric generatorSimon Quellen Field 12 1-7-09  12:47 pm
Hydrogen ElectrolyserJustin 11 9-1-07  12:07 pm
Small ProjectJustin 9-1-07  12:12 pm
Vision system for submarine robotMarcus Shaw 7-24-07  6:15 am
URGENT battery questionHaz 9-4-07  2:05 pm
Human chimpKasper Emil Feld 12-10-07  8:52 am
Amberrock 8-13-07  1:26 pm
DiodeSimon Quellen Field 8-14-07  2:20 pm
Motors and resisting current Pretty urgentHaz 9-4-07  2:07 pm
Fork and plumbSimon Quellen Field 8-23-07  12:54 pm
PIC16F628 and PC comunication via the RS232Justin 8-30-07  11:21 am
Hot Air Balloon Lift Force By Its TemperatureKasper Emil Feld 12-10-07  8:42 am
Need help in building a Potentiostat for Science FairMaria Teresa Pombo 9-4-07  9:25 am
Electric Lighter, NOT piezoelectric Mike 9-13-07  9:51 pm
Homemade water pumpHARSHADRAMESHPATIL 8-26-09  7:43 am
Catapult EquationsChristian 4-24-09  11:23 am
Trip wireMarcus Shaw 10-5-07  8:37 pm
Electrolysis in salt water - makes something greenJustin 11-18-07  10:07 am
F/S: Nokia N95 8GB/Apple iphone 8GB/Sony Ericsson W960/Motorola Riz...bembo 11-27-07  11:44 am
Help plz for my uncle sheepHEY 3-9-08  11:53 am
All questions about all projects of scitoys.comSyed Haider Abbas 119 4-14-08  11:07 am
USB Laser CommunicatorTheresa Simmons 2-6-08  7:35 pm
InductorTheresa Simmons 2-14-08  9:24 am
RC planePatrick 21 3-12-08  6:32 am
Generating EarthquakesRohan 3-14-08  12:06 am
Hey see itRohan 3-13-08  7:07 am
EutrificationKasper Emil Feld 3-14-08  1:26 am
Proppeller AirplanesHobby Quest 3-23-09  2:52 pm
Trebuchet, Catapult, and Ballista DesignTheresa Simmons 3-13-08  10:19 am
C++/Java/VB/BASIC guidancehike danakian 4-3-08  1:25 am
Capacitor chargerPatrick 15 3-27-08  7:39 pm
A QUESTION NOT REALRohan 3-16-08  1:35 pm
HELP CAPACITORWindmill 9-21-08  4:25 am
`lo, Amp! Hi, Volt!Patrick 3-28-08  7:35 pm
STOPPING AIR POLLUTION -KILLING MOSQUITOES-TREATING WASTE WATERRohan 4-24-08  11:57 am
Currentscott 4-13-08  5:40 pm
Solar RefrigeratorJustin 4-20-08  11:00 pm
CapacitorsPatrick 11 4-11-08  7:20 pm
Hydrogen productionTheresa Simmons 4-5-08  12:34 pm
RectennaPatrick 10 4-21-08  4:36 am
ANTENNARohan 4-26-08  2:44 am
How to create a simple beep circuit?Patrick 13 4-29-08  7:29 am
Hydrogen in latex balloonTheresa Simmons 4-24-08  9:34 am
2 questions Patrick 13 4-27-08  6:10 am
Salt alternativeKasper Emil Feld 4-30-08  5:18 am
Golf caddy tyresHaz 4-25-08  5:48 pm
FLEDPatrick 4-26-08  2:33 am
Head, flow and psiJordan 5-15-08  10:31 pm
Simple Laser CommunicatorRohan 8-23-08  8:00 am
Another laser questionPatrick 5-24-08  11:11 pm
Where to find low rpm motors?hey 7-8-08  5:27 am
Any idea of social science projectRohan 7-22-08  2:57 am
Self-inflating Helium Balloon, can it be made?scott 8-6-08  7:47 pm
LASER COMMUNIACTOR QUESTIONSRohan 8-27-08  5:06 am
Pyrolytic graphiteidimov 8-29-08  5:08 am
Infrared led communicator Patrick 9-7-08  12:28 am
Van de graff and CameraJustin Rajewski 11-10-08  10:45 pm
Easy V=IR question for someoneC Peck 11-16-08  7:10 pm
Steering Patrick 7-22-09  5:39 am
Solar regulatorscott 12-13-08  11:33 am
Non-laser Range Finder HELP PLZ!Theresa Simmons 12-29-08  3:09 pm
Amperage of a AA (1.5 volt) batterySam Carlberg 1-18-09  12:33 pm
Need to make a graph for crystal radio Alex Roberts 1-30-09  7:33 pm
Spring Physics Question -- Help!!!11gernez 3-5-09  9:06 am
Alcohol absorbtion efficency11gernez 3-13-09  6:01 pm
Hydrogen fuel cell question....11gernez 3-13-09  6:06 pm
Field's metal and math/chemistry stuffJ N 5-5-09  8:38 pm
Crystal radio with out capacitor and coil calculator Theresa Simmons 6-2-09  2:44 pm
Van de Graaff generator- help pleaseDerrik Walker v2.0 5-30-09  4:25 pm
As the subforum says, I need help with my Science Fair project!Brooke Gasdaska 10-12-09  3:05 pm
What metal is best at reflecting radio waves?Theresa Simmons 10-16-09  3:47 pm
Mixture of solid CO2 and acetone and liquid nitrogen jafra jawabreh 12-30-09  10:18 am
CoilTheresa Simmons 12-31-09  3:32 pm
Questions about the simple crystal radio kitCrystal Liang 2-3-10  6:00 pm
CHLOROPLAST SEQUENCINGKIRAN 2-16-10  10:30 am
12 volt dimmerJimS 2-18-10  12:10 pm
Where to get phosphor powderRed Dragon 4-5-10  7:47 pm
Why does this work?Jon R 8-1-10  7:11 pm
Calculate eddy current force in eddy current separaterNuttapon 11-22-10  10:44 am
  Start New Thread        

Welcome to I need help with my Science Fair project. You may enter any of the discussions above by clicking on the appropriate link. Or, to start a new discussion of your own, click on the "Create New Conversation" button.

Return to Science Toys

Author Message
Top of pagePrevious messageNext messageBottom of page Link to this message

guess (Srqmale)
New member
Username: Srqmale

Post Number: 1
Registered: 3-2006
Posted on Wednesday, March 15, 2006 - 7:03 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Where can I find a one megahertz oscillator? I noticed a ferrite core coil and variable capacitor on a old Am radio that I have. But not a megahertz oscillator.
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1114
Registered: 12-2004
Posted on Wednesday, March 15, 2006 - 7:29 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

We offer them in our catalog.
Top of pagePrevious messageNext messageBottom of page Link to this message

moisdaniel (Pinky)
Junior Member
Username: Pinky

Post Number: 9
Registered: 7-2005
Posted on Friday, April 28, 2006 - 12:12 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Hi! I first want to congratulate you for this amaizing site. It's full of very useful stuff. I thank you for helping us through this forum wich is like a huge library!

I am part of a small school theatre team and we have a play in wich we are in hell, ane I was wondering if you could help us with some ideeas in creating some sort of smoke. I was thinking of the scarry mouvies I seen in wich there was a havy wite very dens on the graound without rising in the air. I don't know that is possible for us, but that was my inspiration.

Thnak you for everithing you are doing for us! (sorry for my grammar)
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1184
Registered: 12-2004
Posted on Friday, April 28, 2006 - 1:14 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

See these sites:
"http://chemistry.about.com/library/weekly/aa010603a.htm"
"http://chemistry.about.com/library/weekly/aa010603b.htm"
"http://chemistry.about.com/library/weekly/aa010603c.htm"
"http://www.samash.com/catalog/showitem.asp?SKU=EEF400XXX"
"http://www.coolstuffcheap.com/fx-800.html"

...and work on that grammar ;-)
The Google Toolbar has a great spell checker for web postings
like this one.
Top of pagePrevious messageNext messageBottom of page Link to this message

moisdaniel (Pinky)
Junior Member
Username: Pinky

Post Number: 10
Registered: 7-2005
Posted on Saturday, April 29, 2006 - 11:12 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Thank for your quick answer!
The links are very ysefull!
But unfortunetly, I have no idee where to get dry ice or liquid nitrogen from!

From what I read in the articles dry ice is solid corbon dioxide and I don't think I will find it in my town for sell!

Thanks again for your help!
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1188
Registered: 12-2004
Posted on Saturday, April 29, 2006 - 9:20 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Both are pretty easy to get where I live (Silicon Valley).
Look in your phone directory.
Top of pagePrevious messageNext messageBottom of page Link to this message

moisdaniel (Pinky)
Member
Username: Pinky

Post Number: 11
Registered: 7-2005
Posted on Sunday, April 30, 2006 - 4:55 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

I searched on Goolge and I found a supplier for Dryice but I don't know haw much to buy
I want to have a 20 cm high sheeat of fog on a area of 10m X 6m.

I was thinking to build the fog machine myself as I found some easy plans as I understood the proces.

I thank you for all your help!
I hope I will be able to pull someting out of my creazy ideeas!
Top of pagePrevious messageNext messageBottom of page Link to this message

rishi kohli (Rishi12)
New member
Username: Rishi12

Post Number: 1
Registered: 5-2006
Posted on Thursday, May 25, 2006 - 3:24 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

does anyone has an idea about the following:

1: an IR rays reciever detects infrared rays coming from a IR transmitter. the recievr has a transistor attached to it which then has a current flowing thru it after IR rays are detected.
now i want to use this current to produce fire . i was thinking of using the concept of an electric lighter but not quite sure how it works.
anyone has an idea?wireless lighter
Top of pagePrevious messageNext messageBottom of page Link to this message

Antariksh Bothale (Antariksh)
New member
Username: Antariksh

Post Number: 1
Registered: 5-2006
Posted on Tuesday, May 30, 2006 - 9:09 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Hello. First of all, I would like to congratulate you for this wonderful site, scitoys.

I made the laser communicator recently and it works out fine.

However, I have three questions:
1. I currently use a very cheap laser pointer (which is more or less a toy) which I bought

for Indian Rupees 20 (<50 cents). The laser spot is quite blurred at the edges and is quite

big in diameter. I have bought two of the them and have managed to spoil both. Both now emit

a very dim light which is of no use. How can I have sure-shot protection against it? Before

I invest in some expensive LASER pointer, I want to know the bearing of the laser's

intensity, size, colour etc. on the reception and it's quality, and also, methods to protect

tle laser.
2. I am finding it hard to get the Audio Output Transformer. I wanted to know if there is

any alternative circuitry which I can substitute for the Transformer, something that will do

the same job.
3. Also, I intend to submit this as a project which students of class XII need to submit for

their Board Examinations (~ GCA 'A' level). Though it is an interesting project,

unfortunately, it doesn't [i]apparantly[/i] require much effort (I know it does require

effort, but it will be hard to get the fact across to the examiner). I wanted to know if I

could extend the project on the same line. For eg. can I use it to transfer data between two

computers? (I saw your Morse Code Transmitter. But I wanted some circuit by which I can

receive via the serial port of the other computer rather than the audio jack). That is,

using Laser as the communication medium, can I perform something which will be even more

dazzling, if not practicable?

P.S. I added it here because I could not find the Add New Conversation button.
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1245
Registered: 12-2004
Posted on Wednesday, May 31, 2006 - 10:00 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

The bicolor LED will protect the laser.

We offer the audio output transformer in our catalog. You could design
a transistor circuit to do the modulation, but the transformer is much
simpler and has much less that can go wrong.

You can make the project more difficult if you like, but I try to do
the exact opposite in my books. You can build two simple telescopes
using fresnel page magnifiers, and use one at the transmitting end and
the other at the receiver, to see how far you can make the signal go.
I would bet that a few miles would be impressive enough.
Top of pagePrevious messageNext messageBottom of page Link to this message

Stojance (Stojance)
Advanced Member
Username: Stojance

Post Number: 63
Registered: 4-2006
Posted on Thursday, June 1, 2006 - 8:01 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Is it possible to write a program in asm and then copy it in my MP3 player and it would do the things that the program said? Because it is an EEPROM (or similar).
Top of pagePrevious messageNext messageBottom of page Link to this message

Richard OBrien (Richard)
New member
Username: Richard

Post Number: 2
Registered: 6-2006
Posted on Saturday, June 3, 2006 - 8:43 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Does any1 know how to make pop pops with easy to find ingrediants?
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1251
Registered: 12-2004
Posted on Saturday, June 3, 2006 - 9:15 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

See "http://sci-toys.com/scitoys/scitoys/thermo/thermo.html#boat".
Top of pagePrevious messageNext messageBottom of page Link to this message

rishi kohli (Rishibond)
New member
Username: Rishibond

Post Number: 1
Registered: 6-2006
Posted on Monday, June 12, 2006 - 9:53 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

does any one has a circuit to build a simpple RF transmitter and a RF reciever.
the ones i came across has encoder and decoders in them. but my trasmitter is fairly simple with jus one button to send a signal .

ny ideas.
Top of pagePrevious messageNext messageBottom of page Link to this message

Stojance (Stojance)
Advanced Member
Username: Stojance

Post Number: 73
Registered: 4-2006
Posted on Thursday, June 15, 2006 - 11:09 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Why blue light appears white over a yellow surface ? :-)
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1304
Registered: 12-2004
Posted on Thursday, June 15, 2006 - 11:37 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

See this page.
Top of pagePrevious messageNext messageBottom of page Link to this message

Antariksh Bothale (Antariksh)
New member
Username: Antariksh

Post Number: 2
Registered: 5-2006
Posted on Monday, July 31, 2006 - 2:54 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Is it possible to get circuit for making puzzles using logical gates. I want to make one.
Top of pagePrevious messageNext messageBottom of page Link to this message

I. Dimov (Overrider)
Advanced Member
Username: Overrider

Post Number: 81
Registered: 12-2005
Posted on Monday, July 31, 2006 - 12:13 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Define puzzle. You can download a couple of programs from the net.
Top of pagePrevious messageNext messageBottom of page Link to this message

J.D. Moore (Jdbabe11)
New member
Username: Jdbabe11

Post Number: 1
Registered: 9-2006
Posted on Monday, September 25, 2006 - 9:59 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

I am currently in an engineering class that requires me to wrok with a group to build a trebuchet. We are thinking aboout building a FAT, but our treb can only be 24" on any side. So we were thinking about mounting the towers on the very front of the base. Do you think that would work, or would we be better off just building a traditional treb? Any help will be appreciated. Thnx.
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1502
Registered: 12-2004
Posted on Monday, September 25, 2006 - 10:48 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

The FAT term stands for "Floating Arm Trebuchet":
"http://www.trebuchet.com/kit/fat/"

How tall can it be? If the weight is attached to a rope, so you can lift it
high and drop it, you will get more power. But that requires that the device
be as tall as possible, so the weight does not hit the ground.

Or I suppose you could dig a hole under the trebuchet to get around height
limitations ;-).
Top of pagePrevious messageNext messageBottom of page Link to this message

Dr. Santosh Jalukar (Drjalukar)
New member
Username: Drjalukar

Post Number: 1
Registered: 11-2006
Posted on Thursday, November 16, 2006 - 6:11 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Stevia and Sorbitol, how the combination may work? Anybody has tried this? What are the results?
Top of pagePrevious messageNext messageBottom of page Link to this message

Michael (Michaelt)
Senior Member
Username: Michaelt

Post Number: 128
Registered: 12-2005
Posted on Friday, November 17, 2006 - 4:02 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Sorbitol is a sugar alcohol which is metabolized very slowly -- although in some it can result in bloating and diarrhea, especially if taken in large quantities.

Stevia has about 300 times the sweetness of sugar, but it's not approved by the FDA as a food additive (a substance used to preserve flavor or improve its taste and appearance), but only as a food supplement. Essentially this means it can be sold in a 'health-food store' as a dietary supplement so long as it not marketed as a sweetener.

Often, artificial and alternative sweeteners have a synergistic effect increasing the sweetness of the finished product versus just using one sweetener, and minimizing the aftertastes that artificial sweeteners often have. This is why many diet colas have combinations of sucralose (Splenda (TM)), acesulfame potassium (Sunett (TM)), and sometimes aspartame (Nutrasweet (TM)) (although aspartame seems to be quickly falling out of favor with soft drink makers.) This synergy of sweetening may also apply to a stevia/sorbitol blend.

I use a liquid saccharin product in my iced tea-- the aftertaste is minimal in iced tea. For hot drinks, I use sucralose as the heat doesn't alter the flavor so much. (Aspartame is practically useless in hot drinks and in baking.)

I have not tried stevia, and I usually find sorbitol in things like toothpaste and gum or cough syrup.

BTW, Simon-- the code on this page is broken and it seems like a discussion thread is appended to the general index of threads. Disconcerting.
Top of pagePrevious messageNext messageBottom of page Link to this message

Carter (Unregistered Guest)
Unregistered guest
Posted From: 209.91.177.176
Posted on Friday, November 17, 2006 - 9:39 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

we are currently trying to get our film cannon cannon to actually consistently fire. We get a spark every time but the cannon only shoots infrequently!!! We are using Binaca as our fuel. Any ideas on how to make this cannon shoot consistently?
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1587
Registered: 12-2004
Posted on Friday, November 17, 2006 - 10:15 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Get good at delivering the same amount of fuel each time.
Also, make sure the can is warm enough -- rub it in your hands first.
Top of pagePrevious messageNext messageBottom of page Link to this message

greg koz (Greg1118)
Advanced Member
Username: Greg1118

Post Number: 62
Registered: 10-2006
Posted on Thursday, November 23, 2006 - 7:39 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Where is is it possible to obtane iodine crystals? Thanks for the help:-)
Top of pagePrevious messageNext messageBottom of page Link to this message

greg koz (Greg1118)
Advanced Member
Username: Greg1118

Post Number: 63
Registered: 10-2006
Posted on Thursday, November 23, 2006 - 7:39 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Where is is it possible to obtane iodine crystals? Thanks for the help:-)
Top of pagePrevious messageNext messageBottom of page Link to this message

abderrezak (Daoudi)
New member
Username: Daoudi

Post Number: 1
Registered: 11-2006
Posted on Sunday, November 26, 2006 - 6:15 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

hi. i need anyone to help me.
i have an homework ,i am student in pharmacy

my homework is :
there is two spray " deep freeze" and "deep heat"
questions:
1-give the active ingredients " include the structures "
2-give thier use " active ingredient" in the formulation
3-comment on the cautions.
4-comment on the name "heat" "freez".

please anyone help me in " 3- and 4- " questions.

my e-mail: daoudi17@hotmail.com
Top of pagePrevious messageNext messageBottom of page Link to this message

sseed (Unregistered Guest)
Unregistered guest
Posted From: 85.12.72.2
Posted on Friday, December 1, 2006 - 9:42 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Hi,

I have built the communicator project but Iam having problems getting it to work. I have used an Oscilloscope to see if a signal is being transfered to the power supply to the laser and it is. The laser works fine.


However when I try and receive anything with either a solar cell or an LDR I get nothing. An CRO on the receiver shows no signal either.

Could it be that Iam using a 1.3k ohm to 2x3.2 ohm transformer and it is just not putting enough signal onto the power supply? Or is it possible that the LDR cannot handle signal changes that fast?

Or do you think there could be a smoothing capacitor on the laser?

Stuart

BTW there seems to be a variable resistor on the laser, any idea what this is for?
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1590
Registered: 12-2004
Posted on Friday, December 1, 2006 - 10:57 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

You could try the laser and transformer we offer in our catalog.
That combination is known to work.

You should be able to see the laser spot on the wall brighten and dim
with the sound volume. If that isn't happening, then you are not
modulating the beam properly. Try the transformer called for in the
instructions.

If the laser is being modulated properly, you can try a solar cell instead
of the cadmium-sulfide cell and battery. There are many types of CDS cells,
and yours may be damaged or inappropriate for this application.
Top of pagePrevious messageNext messageBottom of page Link to this message

Corinne McGuckin (Cori)
New member
Username: Cori

Post Number: 1
Registered: 12-2006
Posted on Thursday, December 7, 2006 - 7:09 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Hi. I am in 7th grade.

I am building the Linear Accelerator for our Science Fair.

What would be the hypothesis statement for the experiment?

I don't plan on testing variations of the set-up, I just want to do the
base experiment.

Right now I have something like "Due to the properties of magnetic fields, magnets can be used accelerate the motion of a steel ball".

But it's rather unwieldy and it doesn't sound quite right.

I appreciate any help.

Thank you.
Top of pagePrevious messageNext messageBottom of page Link to this message

Eddie Adams (Magician)
New member
Username: Magician

Post Number: 1
Registered: 12-2006
Posted on Tuesday, December 26, 2006 - 6:14 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

I am a Magician, a very old one. I am trying to get a trick to work, maybe you can help me. Take a plastic bottle, (mine contained peanut butter).
unscrew the top, lay it face down and using Hot Glue, stick a needle into the center of the cap. Cut a peice of paper about one inches by two inches.
Fold the paper in half, lengthwise and balance it upon the point of the needle.
Carefully screw the bottle on to the cap.
Step back, concentrate a moment, rub your hands together, stepforward, place your hands on both sides of the bottle (without touching the bottle), and cause the paper to rotate.
Shove the bottle toward an onlooker and ask him to do it, He can't.
I think it can be done, using some sort of electrostatic device.
CAN YOU HELP ME MR.SIMON QUELLEN FIELD?

Waiting for your reply,
Magician Eddie

PS: I am mechanically and electrically enclined.
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1606
Registered: 12-2004
Posted on Tuesday, December 26, 2006 - 6:58 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Martin Gardner, famous for the "Mathematical Games" column
in Scientific American, devised the "psychic motor" you describe.
"http://bizarrelabs.com/psychicm.htm"
"http://www.ericberlin.com/reader.html"
"http://www.time.com/time/magazine/article/0,9171,917342,00.html"
"http://www.findarticles.com/p/articles/mi_m2843/is_n1_v20/ai_17849131/pg_2"
Top of pagePrevious messageNext messageBottom of page Link to this message

Corey Meyer (Unregistered Guest)
Unregistered guest
Posted From: 75.50.250.129
Posted on Sunday, January 21, 2007 - 3:57 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Im just wondering if the little things you plug into your tv to recieve ir tranmissions can be used to tranmit? also what are some common places i could find a ir transmitter if that dosent work
Top of pagePrevious messageNext messageBottom of page Link to this message

Randy G. (Unregistered Guest)
Unregistered guest
Posted From: 64.12.117.8
Posted on Sunday, January 21, 2007 - 4:17 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

I have a quick question,
What does an incoming signal from a telephone wire look like.. I'm talking about when the telephone rings. Is it a flat line or does it have some sort of digital signal?

Is it something I can duplicate?

Basicly my application is to use it with a wireless phone. When the phone rings it will use the buzzer to turn on or off the wireless "thing". This what I have a wireless remote.

Thanks,
-Randy
Top of pagePrevious messageNext messageBottom of page Link to this message

Michael (Michaelt)
Senior Member
Username: Michaelt

Post Number: 152
Registered: 12-2005
Posted on Sunday, January 21, 2007 - 11:32 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

The battery voltage (DC) is nominally 48V (actually, -48V). The ringing voltage is often heard to be 90VAC, sometimes decared to be 88V but I've measured it as low as 55VAC before on POTS and have seen voltage selections ranging from 40 to 120VAC on a Nortel PBX (I suppose to accomodate different trunks in different countries). This voltage is superimposed over the DC, which is not disconnected when the ring signal is sent (otherwise, detecting the phone going off-hook (picked up) would not be detected.)

The frequency can be anywhere between 15 and 68Hz in the US. This is analog, not a digital signal.

An interesting application.

One thing to note is that wireless (mobile) and cordless phones generates their own rings internally and don't use the POTS voltage to do that (since they have no direct connection to a POTS.)
Top of pagePrevious messageNext messageBottom of page Link to this message

Phil Collins (Opaphil)
New member
Username: Opaphil

Post Number: 1
Registered: 1-2007
Posted on Tuesday, January 23, 2007 - 5:50 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

How difficult is it to build the kit listed as 'building a radio in ten minutes?'


My 11 year old granddaughter has selected 'building a radio in ten minutes' for her science project. We have ordered the kit, actually 2 of them. I will attempt to make one with one of the kits first and then she will make the other one hopefully just with a bit a help from me.

My concern is how difficult is it to build the radio from the kit? I am a retired accountant by profession and when I look at the list of all the parts, I'm not sure I will be able to make one.

Any comments would be appreciated.
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1624
Registered: 12-2004
Posted on Tuesday, January 23, 2007 - 6:02 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

I like to think it is a simple project, but I have a good deal of experience
soldering up things like this.

There are three places to solder.
Two of those places join three things together, the other joins two things.

You will need a long wire antenna, placed as high as you can get it.
50 feet of wire will do for an antenna, but 500 feet will get better
reception. You can solder the antenna to one of the wires on the coil,
or you can just use an alligator clip to connect them.

The same goes for the ground wire, which should connect to a good ground,
such as a cold water pipe. A good ground is a piece of metal that is
buried in the ground for at least several feet (like a cold water pipe is).

If you want a project that is easier to demonstrate in a science fair
setting, the Three Penny Radio is also easy to put together, and it needs
no ground and no antenna, and it has a built-in amplifier to give you
good volume.
Top of pagePrevious messageNext messageBottom of page Link to this message

hhs (Hhs)
New member
Username: Hhs

Post Number: 1
Registered: 1-2007
Posted on Thursday, January 25, 2007 - 12:08 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

I want to make a laser alarm.
Please help me.

Thanks,
hhs
Top of pagePrevious messageNext messageBottom of page Link to this message

Michael Van Patten (Mvpart)
New member
Username: Mvpart

Post Number: 1
Registered: 2-2007
Posted on Thursday, February 1, 2007 - 1:41 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Tracking Lights Back & Forth
I'm very much the Novice and would appreciate any guidance on where to start,
what to use or where to look, books to read or diagrams to follow, etc...

I'm trying to build a 12"(w) x 24"(h) x 2" (d) lightbox with
1-2 light sources (possibly small 40w incadecent bulbs TBD) which I can automatically
track back and forth (up and down) using a small motor which revolves VERY Slowly.
Also I'd like to set up the motor to a dimmer so that it turns the dimmer on
and off while simultainiously tracking the lights back and forth.

In addition I'd like to have another motor driven device which rotates a clear
disk of transparent film or patterned screen over the lights.

Thank you in advance
Michael Van Patten
Top of pagePrevious messageNext messageBottom of page Link to this message

kislam (Unregistered Guest)
Unregistered guest
Posted From: 72.74.125.165
Posted on Sunday, February 4, 2007 - 10:46 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Hi,
We are trying to build an AM radio transmitter for a school science fair project. Thank you for providing information in your website: (http://sci-toys.com/scitoys/scitoys/radio/am_transmitter.html)

However, I am a bit confused when I see that I have to connect the sound source with the high impedence side (1000 ohm) of the transformer. In another website (http://www.sciencebuddies.org/mentoring/project_ideas/Elec_p024.shtml?from=Home) I see the opposite of this i.e., the low impedence side of the transformer (8 ohm side) is connected with the sound source.

I would appreciate very much if you could please provide the accurate information on this.

Thanks in advance for your prompt response,

Kazi
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1631
Registered: 12-2004
Posted on Monday, February 5, 2007 - 10:13 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Some devices are meant to drive higher impedance headphones, such
as 32 ohms or 16 ohms. Those devices don't have the power to drive
the transmitter unless the transformer is turned around. However, doing
so will reduce the range.
Top of pagePrevious messageNext messageBottom of page Link to this message

Freddie Colllier (Unregistered Guest)
Unregistered guest
Posted From: 67.176.128.198
Posted on Wednesday, February 7, 2007 - 6:30 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

i need help! I am currently in 8'th grade and i have to come up with an invention. For my invention my group is planning to make something that can sweep or vacume up crumbs from the floor os that old people do not have to bend over and possibly throw out their backs when they sweep. my group is planning to build off of this robot ( http://www.henrys.co.uk/gadget/hyper%20peppy.html) their are a few problems:
1. the wild spastic movement of the robot will scare old people and it will be too hard for them to catch.
2. Neither one of us have any experience in building robots.
3. We dont have any ideas that can slow down the robot (hoping to make it scan for crumbs is too much like the "Roomba" right? could we get sued?)
4. How could we attach a small enough broom, shovel or or vacume?

I know this is a lot of stuff and since i cannot bookmark this page and may lose it, can you post your responses here can email them to me @ chaosrules221@gmail.com
Top of pagePrevious messageNext messageBottom of page Link to this message

Freddie Collier (Chaosrules221)
New member
Username: Chaosrules221

Post Number: 1
Registered: 2-2007
Posted on Wednesday, February 7, 2007 - 7:26 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

same person, i just signed in :-) :-) :-) <(^_^)>

i need help! I am currently in 8'th grade and i have to come up with an invention. For my invention my group is planning to make something that can sweep or vacume up crumbs from the floor os that old people do not have to bend over and possibly throw out their backs when they sweep. my group is planning to build off of this robot ( http://www.henrys.co.uk/gadget/hyper%20peppy.html) their are a few problems:
1. the wild spastic movement of the robot will scare old people and it will be too hard for them to catch.
2. Neither one of us have any experience in building robots.
3. We dont have any ideas that can slow down the robot (hoping to make it scan for crumbs is too much like the "Roomba" right? could we get sued?)
4. How could we attach a small enough broom, shovel or or vacume?

I know this is a lot of stuff and since i cannot bookmark this page and may lose it, can you post your responses here can email them to me @ chaosrules221@gmail.com
Top of pagePrevious messageNext messageBottom of page Link to this message

jimmydharia (Unregistered Guest)
Unregistered guest
Posted From: 202.88.141.233
Posted on Thursday, February 22, 2007 - 1:25 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

hey i in engineering final year n i m making a project in which i have t communicate between two pc wirelessly plz.. tell me the various option i m really confused i tried the pc based morse code circuit but then i has no circuit for a receiver just a radio n the range is bad pl.. help m wit this urgently
Top of pagePrevious messageNext messageBottom of page Link to this message

jimmydharia (Unregistered Guest)
Unregistered guest
Posted From: 202.88.141.233
Posted on Thursday, February 22, 2007 - 1:34 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

hey i m in my final yer engineerin n i m working on a project in which i need
to communicate between two pc's i tried the morse code circuit bt then the range is bad can aqny one suggest me other methods for comminication n also the pc based transittr has no receiver circuit i need a circuit that will first encryt my text nthen transmit it plz. i need help ugetly
Top of pagePrevious messageNext messageBottom of page Link to this message

Bob_g (Bob_g)
New member
Username: Bob_g

Post Number: 1
Registered: 2-2007
Posted on Friday, February 23, 2007 - 5:03 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

On the Gauss Rifle project, I’m looking for suggestions on measuring the relative output energy for different magnet configurations (number, position, type, etc.). Been considering a weighted target on the end of a pendulum arm and then measuring and comparing the angles that the arm swings for each config.

Any other suggestions out there that are simple to implement and repeatable?

Thanks!

Bob
Top of pagePrevious messageNext messageBottom of page Link to this message

Amauboussin (Unregistered Guest)
Unregistered guest
Posted From: 69.120.91.62
Posted on Wednesday, February 28, 2007 - 7:46 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Does anyone know where I can get steel balls for the gauss rifle?
Top of pagePrevious messageNext messageBottom of page Link to this message

ofarrelld (Unregistered Guest)
Unregistered guest
Posted From: 143.239.130.189
Posted on Friday, March 2, 2007 - 4:32 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Hi I was just wondering if anyone knew the strength of the magnetic field generated by the 12mm cube magnets??
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1645
Registered: 12-2004
Posted on Friday, March 2, 2007 - 11:46 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

They are 50 MegaGaussOersteds.
As the technology improves, we will always have the most powerful magnets
available. At the time of this writing, that is 50 MGOe.
Top of pagePrevious messageNext messageBottom of page Link to this message

ofarrelld (Unregistered Guest)
Unregistered guest
Posted From: 89.234.114.88
Posted on Saturday, March 3, 2007 - 10:20 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Thanks for the reply but I'm still a little confused. I've never came across those units before, I gather that t=its to do with the prduct of B and H but would you have any idea of say the magnetic field strength, in gauss, between two of these magnets about 10 inches apart?? Thanks for the help.
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1646
Registered: 12-2004
Posted on Saturday, March 3, 2007 - 4:41 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

What is it you need to do with the magnets?

You are asking for gauss, which is like asking for current in
an electrical circuit. Without knowing the voltage also, it is
hard to compare two things by current alone.

The total energy product of a magnet is similar to watts in an
electrical circuit. It is the product of the intensity of the
field and the flux.

A larger magnet will have more flux, but not more intensity.
This is like having a larger hole in a dam. You have more flow,
but the same pressure.

For some applications, the intensity of the field is more important
than the amount of flux. For a spark plug, the voltage is more
important than the current. Not enough voltage, and you don't get a
spark.

In applications like the Gauss Rifle and the magnetic levitation
projects, what matters is the total energy product divided by the
mass.

In the end, it may make no difference to you. These are the most powerful
magnets currently available. When the technology improves, we will offer
the improved magnets.
Top of pagePrevious messageNext messageBottom of page Link to this message

ofarrelld (Unregistered Guest)
Unregistered guest
Posted From: 143.239.130.189
Posted on Wednesday, March 7, 2007 - 7:38 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Thanks for the reply, I think I've figured out what you mean by the energy product. I was planning on using them to create a magnetic field in a plasma device to increse the confinment.
Top of pagePrevious messageNext messageBottom of page Link to this message

Daniel (Unregistered Guest)
Unregistered guest
Posted From: 24.28.78.210
Posted on Saturday, March 10, 2007 - 10:35 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

I need some help with my Van de Graaf generator please look at my subject that says SERIOUS VAN DE GRAAF PROBLEMS. I would really enjoy some help.
Top of pagePrevious messageNext messageBottom of page Link to this message

whatever whatever (Unregistered Guest)
Unregistered guest
Posted From: 71.102.14.163
Posted on Saturday, March 31, 2007 - 2:42 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

I was reading the laser data transmitter page and i couldn't find the morse code software for mac? sorry, I couldn't use my real name.
Top of pagePrevious messageNext messageBottom of page Link to this message

Randy (Unregistered Guest)
Unregistered guest
Posted From: 205.188.116.8
Posted on Saturday, March 31, 2007 - 6:41 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

With the Digital thermometer... you had said it didn't need a reference temp so my question is since this makes electricity does it make electricity directly from the heat? If so could you make a bunch of these and make a small "battery" powered by the air temp?
-Randy
Top of pagePrevious messageNext messageBottom of page Link to this message

Randy (Unregistered Guest)
Unregistered guest
Posted From: 205.188.116.8
Posted on Saturday, March 31, 2007 - 6:47 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Nevermind I just reread the page and I saw a 9v battery... so nevermind about what i just said.
-Randy
Top of pagePrevious messageNext messageBottom of page Link to this message

James (Teamsr195)
New member
Username: Teamsr195

Post Number: 1
Registered: 7-2007
Posted on Thursday, July 12, 2007 - 8:03 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

I am trying to build a motor that will run on a cable. I need the motor to be able to support about 10 pounds with a variable speed control. I would like to be able to run a max of about 15 mph. Also once the pully reaches the end of the cable I need it to have a switch that will trip and reverse the polarity so it will go forward and reverse. What do I need to make this work? I have a basic idea but have never built anything like this before.
Top of pagePrevious messageNext messageBottom of page Link to this message

Haz (Pyrohaz)
Intermediate Member
Username: Pyrohaz

Post Number: 31
Registered: 8-2006
Posted on Friday, August 10, 2007 - 4:44 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Hi, i was wondering, which kind of light will suit best for my electric scooter, would it be:

1. LED's at 5v (the 5v being converted down from 24v using an 7805 regulator)
2. Halogens at 12v (using an 7812 regulator)
3. Anyone got any other ideas?
Top of pagePrevious messageNext messageBottom of page Link to this message

Maria Teresa Pombo (Maria_teresa)
New member
Username: Maria_teresa

Post Number: 1
Registered: 8-2007
Posted on Monday, August 20, 2007 - 9:33 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Hi My son is an honor student who just started his 8th grade. He has entered Science Fairs in his school for two consecutive years. He won First Place in his school for a project measuring static in several materials and then won third place in the Regional Fair. Last year, he competed in the area of physics and structures with a project that analyzed the strength of the spider web and did an experiment with LEGO blocks to see whether a building supported with a spider like web would withstand stronger hurricane force winds than the unsupported one . He again won first prize at his school and this time second place in the Regional Fair.

This year he is interested in pursuing a project on electromagnetic levitation and would like to propose to do an experiment on whether gravity could affect the growth of bacteria in Petri dishes. The problem is to have the bacteria experience weightlessness with a gravitational force. Is this something that could be done? Could you offer us some suggestions? Any other projects you could suggest for him to pursue using this topic? We saw the post from an 8th grader that was interested in doing a similar project and your response but we could not find much information on how to build a decent sized water cooled electromagnet to be able to have the bacteria experience weightlessness.



We would deeply appreciate your guidance and valuable time. Any other suggestions for a project on this topic would be appreciated.
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1772
Registered: 12-2004
Posted on Monday, August 20, 2007 - 10:42 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

The kind of electromagnet used to levitate water is a Bitter Solenoid.
They are generally out of reach for amateurs, since the power and water
requirements are those of a small town, not a small house.

However, just as people floating in water experience simulated weightlessness,
a bacterial culture in a liquid medium should also not be able to tell up
from down if the medium had the same density as the organism.

Determining whether weightlessness was the cause of differences (as opposed to
surface effects, diffusion, differences in culture media, etc.) might be
difficult. But rotating the culture on a Ferris-wheel type of structure
might be simulation enough.
Top of pagePrevious messageNext messageBottom of page Link to this message

Maria Teresa Pombo (Maria_teresa)
New member
Username: Maria_teresa

Post Number: 2
Registered: 8-2007
Posted on Monday, August 20, 2007 - 3:32 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Thanks so much for your prompt response. We will research a possible liquid medium with the same density as the organism in the Petri dish. It seems pretty hard though. Rotating the culture on a Ferris-wheel type structure sounds like a better alternative.

We have searched the area of biomagnetism/bioelectromagnetics and think that a project dealing with this area would be extremely interesting. Any suggestions as an alternative project?
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1773
Registered: 12-2004
Posted on Monday, August 20, 2007 - 3:43 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Several soil bacteria use magnetism to know which direction is 'up'
(since everywhere except the equator, a compass needle points down
as well as north, and the farther north or south, the more down it points).

You might see if you can capture and isolate them by stirring mud with
a lot of water in a bucket, and holding a large or strong magnet to the side
of the bucket. Then culture them to further isolate magnetic species.

It might also be interesting to see whether magnetic species are predominantly
aerobic or anaerobic. They may be heading down to avoid oxygen.
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1774
Registered: 12-2004
Posted on Thursday, August 23, 2007 - 11:40 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

If your son is still in the process of picking a topic, instead of trying to
control gravity, it is much easier to control magnetism. Seeing what effect
strong magnetic fields have on colony growth of various bacteria in an agar
plate could be quite interesting.

Questions such as "Are anaerobic microorganisms more likely to be affected by
a magnetic field than aerobic organisms" might be an interesting topic. The
hypothesis that organisms use the magnetic field in order to avoid oxygen
would be tested.
Top of pagePrevious messageNext messageBottom of page Link to this message

Maria Teresa Pombo (Maria_teresa)
Junior Member
Username: Maria_teresa

Post Number: 4
Registered: 8-2007
Posted on Thursday, August 23, 2007 - 12:07 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Thanks so much!! We will pursue your suggested topic instead!!
Top of pagePrevious messageNext messageBottom of page Link to this message

paulo melendez (Paul0)
New member
Username: Paul0

Post Number: 2
Registered: 9-2007
Posted on Saturday, September 1, 2007 - 8:51 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

"You can build your own earphones using a tin can, a nail, a small magnet, and some fine wire. Wind a few hundred turns of wire around the nail. Let the magnet stick to the head of the nail (a neodymium-iron-boron supermagnet in our catalog works well here, since it is strong and very small). Attach the coil to the radio in place of the earphones. Hold the open end of the tin can to your ear, and hold the nail very close to the bottom of the tin can. The bottom of the can will be attracted to the magnet, but the coil will make it vibrate with the sound from the radio."

Can i get a photo of this? Thanks in advance
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1786
Registered: 12-2004
Posted on Saturday, September 1, 2007 - 12:45 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

While I enthusiastically support people building their own
magnetic earphones, I should point out that the materials
for making one are more expensive than buying a piezoelectric
earphone and the latter is smaller, lighter, and more sensitive.
Top of pagePrevious messageNext messageBottom of page Link to this message

jack william (Unregistered Guest)
Unregistered guest
Posted From: 67.184.24.225
Posted on Thursday, October 25, 2007 - 8:27 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

What factors effect the balance of a sphere on a flat surface?
Top of pagePrevious messageNext messageBottom of page Link to this message

Gokul Sriram (Dgpride)
New member
Username: Dgpride

Post Number: 2
Registered: 11-2007
Posted on Saturday, November 17, 2007 - 2:46 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

I have come to know about "Building a computer controlled radio transmitter". While doing this, won't it affect motherboard??? how much power will it draw to transmit signal using 1MHZ crystal oscillator??? wt's the maximum frequency i can use? how much an oscillator will cost??
Building a computer controlled radio transmitter
Top of pagePrevious messageNext messageBottom of page Link to this message

Gokul Sriram (Dgpride)
New member
Username: Dgpride

Post Number: 3
Registered: 11-2007
Posted on Saturday, November 17, 2007 - 2:53 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

cont....

Top of pagePrevious messageNext messageBottom of page Link to this message

moustafa ibrahim moustafa (Mosnfady)
Junior Member
Username: Mosnfady

Post Number: 4
Registered: 5-2007
Posted on Monday, December 3, 2007 - 12:13 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

hi, i need a help plz to get an idea or any device ( ready ) that can know the place of my lost sheep, my uncle is a sheepherder , and always have a problem ( loss one or two sheep )in the desert,
Top of pagePrevious messageNext messageBottom of page Link to this message

Le'Andre Bean (Leandrebean)
New member
Username: Leandrebean

Post Number: 2
Registered: 12-2007
Posted on Saturday, December 8, 2007 - 11:18 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

I was wondering if anyone knows about the computer controlled transmitter? I love it and I am interested in trying it but would like to know if you can use a HC-49\U package crystal oscillator (the kind used in R/C cars) and if so how exactly would you do so? Thanks in advance!!!
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1813
Registered: 12-2004
Posted on Monday, December 10, 2007 - 9:58 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Those are crystals, not crystal oscillators.
You need the four legged parts, not the two legged ones.
Top of pagePrevious messageNext messageBottom of page Link to this message

Syed Haider Abbas (Haider_abbas)
New member
Username: Haider_abbas

Post Number: 2
Registered: 12-2007
Posted on Sunday, December 30, 2007 - 12:07 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

hello,
i am your new friend.Please respond me.I have a problem.I want to make a RC car but the big problem is RC transmitter and receiver.
So please tell me how to make RC transmitter and receiver i want a cool RC car. The another big problem is the engine.I don,t know that from which material i can make engine i want an electric engine.
Top of pagePrevious messageNext messageBottom of page Link to this message

Tim Dietenhofer (Timdietenhofer)
New member
Username: Timdietenhofer

Post Number: 1
Registered: 1-2008
Posted on Monday, January 7, 2008 - 1:13 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

I have just built your "a simple laser communicator" and the audio is so faint in the earphone I can hardly hear it. I am using everything you suggest in your parts list. the only success I have had to get it louder was to buy an expensive high power laser pointer from Staples.

Is there something else I could have done?
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1826
Registered: 12-2004
Posted on Monday, January 7, 2008 - 2:22 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

The power of the laser has no effect on the sound volume.
That would only affect the range.

To make the sound louder, increase the volume of the device that you
are using for the signal source, or amplify the output from the solar cell.
Top of pagePrevious messageNext messageBottom of page Link to this message

Tim Dietenhofer (Timdietenhofer)
New member
Username: Timdietenhofer

Post Number: 2
Registered: 1-2008
Posted on Monday, January 7, 2008 - 9:49 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

"a simple laser communicator"

I have the volume turned all the way up on the signal source (a radio), how can i amplify the output between the solar cell and the earphone - a battery?
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1828
Registered: 12-2004
Posted on Tuesday, January 8, 2008 - 9:42 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Try a different radio. It sounds like the radio you are using is
designed to drive 16 or 32 ohm earphones instead of 8 ohms. That
means it does not have enough power to send a loud signal to the
laser. An alternative is to turn the transformer around, so the
three leg side is connected to the radio, and the two leg side to
the laser.

You can tell when the laser is properly modulated because the sounds
from the radio will make the laser visibly dim and brighten with
the music.

To amplify the signal at the other end, connect the photocell to a
cable that plugs into the input of an amplifier, such as a stereo
or tape recorder, instead of to the earphone.
Top of pagePrevious messageNext messageBottom of page Link to this message

Tim Dietenhofer (Timdietenhofer)
New member
Username: Timdietenhofer

Post Number: 3
Registered: 1-2008
Posted on Tuesday, January 8, 2008 - 11:53 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

The radio output is 8 ohm (checked with a meter). the xfmr has 8 ohms on the two leg side and 680 ohm on the three leg side (rated 1000, is it defective?).

When connected as per diagram the laser lights up but does dim or brighten although the Led does pulse when I increase the volume.

(when I reverse the transformer there is no audio at all)

As I asked earlier, how loud should the audio be if this thing is working right (using the piezoelectric earphone and a solar cell)? at the moment it is so faint you can hardly hear anything.

I feel like an idiot, as this is a simple project, but do not see where I have gone wrong.
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1832
Registered: 12-2004
Posted on Wednesday, January 9, 2008 - 9:38 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

You can't check the output impedance of a radio with a ohmmeter.
Likewise, the impedance of a transformer can't be measured with an ohmmeter.
It is specified in ohms, but at 1,000 hz AC, not DC.

The volume should be comfortable, not faint.

Your transformer is fine.

Try different radios as the sound source.
Top of pagePrevious messageNext messageBottom of page Link to this message

Tim Dietenhofer (Timdietenhofer)
Junior Member
Username: Timdietenhofer

Post Number: 4
Registered: 1-2008
Posted on Saturday, January 12, 2008 - 1:04 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

"A simple laser communicator"

Well It turned out to be the laser I purchased at Radio Shack!

A word of advice to those trying this experiment...the cheap lasers they sell are too weak to put out a strong enough signal to be heard.

I ended up using a laser/light/pen I got as a Xmas gift from a customer and it worked great.

Thanks for your help.
Top of pagePrevious messageNext messageBottom of page Link to this message

Ichabod Crane (Unregistered Guest)
Unregistered guest
Posted From: 65.57.245.11
Posted on Tuesday, January 22, 2008 - 11:29 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

It sounds more like the laser was too "stiff" to modulate,
rather than not strong enough. In other words, the light was
bright enough, but the transformer could not make it change
brightness.
Top of pagePrevious messageNext messageBottom of page Link to this message

Julie Mehta (Unregistered Guest)
Unregistered guest
Posted From: 205.188.116.8
Posted on Monday, January 28, 2008 - 8:18 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Hi,
I have a question regarding my kids science fair project. We want to show bacteria growth on lots of different surfaces. I was wonein how far in advance can you do this before the show. I have read online and it seems to take about 48 hours in a dark place to grow the bacteria. I want to do this as far ahead as I can so we do not wait until the last minute to get the project done.

Does the bacteria keep growing one it is in the light. Does it stay the same.

Any advice would be apreciated.

Thanks.

Julie
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1849
Registered: 12-2004
Posted on Monday, January 28, 2008 - 8:55 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Bacteria will continue to grow.
If you want to stop growth, put them in the freezer.
Top of pagePrevious messageNext messageBottom of page Link to this message

Julie Mehta (Unregistered Guest)
Unregistered guest
Posted From: 205.188.116.8
Posted on Monday, January 28, 2008 - 12:58 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Thanks for th info. about the bacteria growth. I have another question. I wanted to get samples from playground equiptment but it is winter here. Will there still bacteria on the playground toys in the cold. I am new to this so I appreciate your help. I just don't want to take samples if it isn't the right time.

Thanks again.
Top of pagePrevious messageNext messageBottom of page Link to this message

Theresa Simmons (Theresa)
Junior Member
Username: Theresa

Post Number: 4
Registered: 1-2008
Posted on Monday, January 28, 2008 - 5:20 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

If there is dirt on the equipment, the bacteria there will grow fine once
you warm it up inside.
Top of pagePrevious messageNext messageBottom of page Link to this message

Hope Spellman (Unregistered Guest)
Unregistered guest
Posted From: 76.6.78.223
Posted on Thursday, January 31, 2008 - 7:50 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

I need help coming up with a science fair project
Top of pagePrevious messageNext messageBottom of page Link to this message

Randy G. (Unregistered Guest)
Unregistered guest
Posted From: 76.5.106.57
Posted on Saturday, February 2, 2008 - 9:37 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Question here:
"What is the easiest way to transfer a complex circuit onto a circuit board for ecthing?" I have the circuit on the computer.
I don't have photo sensitive boards. I do have an Inkjet print but not a laser printer.
Sharpies are no good for this circuit because it is too big and too complex.
Any Help would be GREAT
-Randy
Top of pagePrevious messageNext messageBottom of page Link to this message

steven brierley (Steve10)
New member
Username: Steve10

Post Number: 1
Registered: 4-2008
Posted on Monday, April 21, 2008 - 8:21 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Question please:
I am going crazy, trying to figure out, on how to build a simple "beep circuit". What makes the sound? I just wwant to create a simple loop, with a push button, where I can make a beeping sound ( like the sound of a microwave touch pad). I have batteries, speakers,push buttons, wires, ect. everyhting I believe I need to make the simple loop, except what acually makes the beep sound itself. please help

Thanks, steve
Top of pagePrevious messageNext messageBottom of page Link to this message

vaishali mahiras (Vaishu3912)
New member
Username: Vaishu3912

Post Number: 1
Registered: 8-2008
Posted on Wednesday, August 13, 2008 - 7:10 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

ineed help in my project, of producing electricity by compreesed air.
Top of pagePrevious messageNext messageBottom of page Link to this message

Rohan (Digital)
Senior Member
Username: Digital

Post Number: 125
Registered: 3-2008
Posted on Wednesday, August 13, 2008 - 10:21 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

take compressed air in a tank and make a small opening in that and attach a valve with it then take a low rpm motor or ur generator and attach a turbine with it and place it near the tank near the opening. open the valve and the turbine will move and ur generator will produce electricity.
are u from india?
Top of pagePrevious messageNext messageBottom of page Link to this message

Don Root (Signbonkers)
New member
Username: Signbonkers

Post Number: 1
Registered: 8-2008
Posted on Saturday, August 23, 2008 - 3:53 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Wow! Awesome site, everybody... I am trying to build a set of bone conduction headphones to wear at work. I work in an incredibly loud production environment where we wear those 'squishy' foam earplugs 12 hours a day. It would be cool to be able to listen to music while I work, but OSHA regulations won't let us wear any kind of covering directly over our ears (walkman type ear phones, ear muffs, etc.) From what I've read, bone conduction headphones make a lot of sense, but I haven't had much luck in finding 'Bone Conduction Headsets R us' in my local phone book.
Plus, it'd be way cooler to build my own set. Any thoughts? -Don Root
Top of pagePrevious messageNext messageBottom of page Link to this message

idimov (Unregistered Guest)
Unregistered guest
Posted From: 78.142.26.88
Posted on Saturday, September 20, 2008 - 5:39 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Hello, it's me I. Dimov. I finally managed to get the radio working. Turns out it was my solder joints and the diode. So just to give a few tips. If you can't find a Germanium, a 1N5819 Schottky diode, would work great. Use a wire loop antenna. Use the LM386 amp. Anyways, SQL, could you post another radio project, for example a superheterodyne receiver?
Top of pagePrevious messageNext messageBottom of page Link to this message

aaron cortelyou (Chekhonte)
New member
Username: Chekhonte

Post Number: 1
Registered: 11-2008
Posted on Thursday, November 6, 2008 - 10:05 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

I'm trying to build a ferrofluid sculpture and need to build a pretty powerful electromagnet but I need help choosing a power supply and determining the amount and diameter of magnet wire to use. If you do a search on youtube for ferrofluid you can find one of the sculptures I'm talking about. The first or second choice will be morpho towers. It's pretty amazing stuff.

How many amps should my DC powersupply be? Will 30 watts be enough? Where would you recommend getting a power supply? My only limitation is expense. I don't want to spend more than 450 dollars on the power supply.

Thanks in advance for any help and advice that you may give!

Aaron Cortelyou

PS How do you create a new topic?!
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1922
Registered: 12-2004
Posted on Saturday, November 8, 2008 - 6:03 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

The strength of an electromagnet depends on two things.
The current, and the number of turns.

The diameter of the wire should be big enough to handle the current.
The voltage of the power supply and the resistance of the wire will
determine the current.
The length of the wire will determine the resistance.

Obviously, you will need to know how many ampere-turns of magnetic field
you want in order to determine the current and the number of turns. That
is information you have not supplied.

A car battery would be a fine power supply for a large electromagnet.
Top of pagePrevious messageNext messageBottom of page Link to this message

Darrin Sir (Dedub)
New member
Username: Dedub

Post Number: 1
Registered: 11-2008
Posted on Tuesday, November 18, 2008 - 7:52 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Hello, I just put together the simple am transmitter but it doesn't seem to work. I can here dead space on 1000 Khz but nothing from the input I'm using. I've tried two different MP3 players, flipping the audio transformer and swapping out the oscillator (I bought two). When I unplug the power from it I get the normal am rush on the radio but like I said, when powered up, I get dead air. Has anyone else had this issue?

Darrin
Top of pagePrevious messageNext messageBottom of page Link to this message

Theresa Simmons (Theresa)
Advanced Member
Username: Theresa

Post Number: 77
Registered: 1-2008
Posted on Tuesday, November 18, 2008 - 8:06 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

The static is quieting, so your oscillator is working fine.
Your problem is that you aren't modulating it.

This is usually caused by a weak input signal.
Try a radio or other source that uses an 8 ohm earphone,
instead of the 32 ohm stereo phones that MP3 players
usually use.

Of course, you could be connecting to the MP3 player
wrong. If you put an 8 ohm speaker instead of the
transmitter, you should be able to hear the signal.
If you can't, get a better signal source, or amplify
the one you have.
Top of pagePrevious messageNext messageBottom of page Link to this message

Darrin Sir (Dedub)
New member
Username: Dedub

Post Number: 2
Registered: 11-2008
Posted on Saturday, November 22, 2008 - 7:54 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Thanks Theresa,
Great suggestions but I figured out what was wrong. The page that has the instructions on how to construct the transmitter is wrong. First, the transformer that is displayed is not the one that showed up at the door. The schematic shows the transformer with a tap at the input side and has a 1000 ohm impedance. The one in the pictures also have the leads color coded. The one I got the leads are not color coded and the tap is on the other side of the transformer. Therefore, I had the transformer backwards the whole time but I was just following the schematic. I'm good to go now!
Thanks
Darrin
Top of pagePrevious messageNext messageBottom of page Link to this message

Dudley Swiney (Unregistered Guest)
Unregistered guest
Posted From: 98.212.163.55
Posted on Sunday, January 11, 2009 - 11:56 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Hi,
My son and I are working on some electronics projects. I remember in middle school shop class making this simple shocker I wanted to do with him.

It was based around a transformer we wound ourselves. On one side was a d battery and switch. on the other size of the transformer it was just two pieces of copper tubing that you would hold on to while your "friend" pulsed the switch. It was a good jolt when you could cycle it fast enough.

so my problem is I can't remember the details of the transformer. Could someone help me. I don't remember what was at the middle or what kind of wire we used. It seems like we wrapped a small amount of wire around a nail or something. Then wrapped a larger amount around the first coil of wire.

Any suggestions as to how to make this transformer, that would be suitable for 9yos? :-) Tell me what to use at the center, what type of wire to use, how many turns each, do I just wrap one set on top of the other and other things I don't know to ask.
(I know I could use a ready made transformer, but this kid needs things to do.)
Your help is greatly appreciated.
Dudley
Top of pagePrevious messageNext messageBottom of page Link to this message

John Michaels (Has91)
New member
Username: Has91

Post Number: 1
Registered: 1-2009
Posted on Monday, January 12, 2009 - 8:25 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Hi. I’m doing a science project in high school, in which I dismantled a microwave, and took the microwave magnetron, capacitor (no need to worry; the capacitor was discharged) and transformer out.

Before I go on, the premise of the project was to get a magnetron to emit a microwave, which would be received by a rectenna (composed of an isolated microwave antenna—in this case a wi-fi antenna, connected by wire to a Schottky diode) which rectifies the AC current and turns it into DC current. In other words, wireless power transmission.

Now, I’m particularly having trouble with the transformer. I’m planning to hook up the apparatus to a variable power supply, in which in the science classroom, has an outlet that you can put wires into. One hole is for positive current, another is for negative current.
The variable power supply is in one room, the outlet for the two holes is in another.

This poses a problem, as I have a normal electrical plug (you know, for common household electrical outlets) for the microwave (which is connected to the control board AND eventually to the transformer). The transformer is a step-up transformer. The input has two flat knobs (almost like those on an normal electrical plug), and the output has other knobs that I was able to connect to the capacitor and the magnetron via wire. I supplied the link to a diagram of the transformer at the end of this post.

I’d like to bypass the controls and be able to directly wire the transformer to the variable power supply via the two holes (+ and -) instead of plugging it into the electrical outlet, that way I can directly control the voltage of the current going into the transformer, instead of having a steady voltage from the normal electrical outlet.

How can I make this possible? I don’t know how to distinguish between the two input knobs on the transformer (where to plug into positive and where to plug into negative).

I was wondering if it was possible I can use 18-gauge wire to connect into the two variable power supply holes, and connect it to the two input knobs on the transformer via alligator clips.

Here is the link to a diagram of a transformer that is extremely similar to mine:

http://www.gallawa.com/microtech/images/xform.gif

Pardon me for the extremely long explanation (more info is better than less).

I would greatly appreciate your help.

Thanks,

Has09

(Message edited by has91 on January 12, 2009)
Top of pagePrevious messageNext messageBottom of page Link to this message

Theresa Simmons (Theresa)
Advanced Member
Username: Theresa

Post Number: 100
Registered: 1-2008
Posted on Monday, January 12, 2009 - 9:43 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

It sounds like your variable power supply is providing direct current.
Transformers need alternating current.

I presume the reason you want the variable power supply is to limit
the amount of power you put into the magnetron, so you don't cook
all the people around it.

A microwave oven puts out about a kilowatt when run on 120 volts AC.
That's about 8 and a third amperes of current.

Assuming you want no more than about 50 milliwatts of output, so you
don't cause cataracts in all the bystanders, you will want to reduce
the power by a factor of 20,000. The final voltage would then be 6
millivolts. A variable AC power supply that can supply 8.33 amps at
6 millivolts might be hard to find.

Keeping the voltage at 120 volts, but limiting the current to 40 milliamps
might be a more tractable solution. Or use a cheap AC wall-wart transformer
to both limit the current and reduce the voltage.

Something like this:
"http://parts.digikey.com/1/parts/730463-transformer-wall-24vdc-50ma-212as24005.html"

The output is 24 volts at 50 milliamperes. That's still 1.2 watts,
but you can get this one instead:
"http://www.digikey.com/scripts/DkSearch/dksus.dll?Detail&name=T701-ND"
which is 9 volt output at 100 milliamps, or 0.9 watts. That may be close
enough, and you can always put a resistor in series at the output to
limit the current further. Add a variable resistor, and you have a
variable AC power supply.
Top of pagePrevious messageNext messageBottom of page Link to this message

John Michaels (Has91)
New member
Username: Has91

Post Number: 2
Registered: 1-2009
Posted on Monday, January 12, 2009 - 10:30 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Ms. Simmons,

Thank you for your help. The variable supply box has several DC settings and one AC setting (voltage is adjustible), so I think it'll suit me. The links were helpful as well.

Is it possible to shield the microwaves emitted by the magnetron? (do they travel in a straight line from the magnetron itself?)

Also, given that I will be using the AC current setting, I have a question... There are two terminals in the wall, with one hole per each (presumably in which I can insert the wire). One terminal is red (indicating positive current) while the other is black. I would like to bypass the microwave's controls (with the menus) as well as the connectors to the lightbulb and the fan, so I'm wondering if I can -not- use the microwave oven's electrical plug. There are two flat knobs for the input into the transformer, so is it possible to directly connect the terminal to the transformer?

Thanks very much,
John Michaels
Top of pagePrevious messageNext messageBottom of page Link to this message

Theresa Simmons (Theresa)
Senior Member
Username: Theresa

Post Number: 101
Registered: 1-2008
Posted on Tuesday, January 13, 2009 - 12:24 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

The power supply can probably source more current than you can safely use.

The magnetron will emit microwaves in many different directions at once.
I have been assuming you or the person providing the power supply and
the venue were aware of the dangers of both 120 VAC power and microwave
energy, but in view of your questions that may have been optimistic.

You need to be absolutely certain that the input power to the magnetron
is limited to safe levels. I would not exceed 50 milliwatts. That means
measuring both the voltage and the current simultaneously, and making sure
that the product of the two (volts times amps) does not exceed 0.050 (watts).

A small transformer such as the one in the second link I provided can only
source 100 milliamperes of current, and provides 9 volts, making the nominal
power under one watt. In practice, a short circuit would probably exceed a
watt by a little bit. Putting a resistor in series with the output of the
transformer would limit the current (and thus the power) to safe levels.

The foregoing is all based on the assumption that the magnetron will even
work at reduced voltage. This may not be the case. If getting the magnetron
to emit microwaves requires that 120 volts be provided at the input, then
the current will have to be limited much further.

An easy and fairly safe way to do this is to get two of the small transformers,
and connect their secondaries together. The first transformer will reduce the
current to safe levels, and the voltage to 9 volts. The second one, because
it is reversed, will raise the voltage back to 120 volts, while keeping the
total power output below a watt (and thus the current to about 8 milliamperes).

A current limiting resistor would still be a good idea. Measure the current,
and the voltage, and use Ohm's Law to calculate the resistor needed to limit
the current until the output power is below 50 milliwatts.

You will want to shield the microwaves to keep them away from people, even
at these lower levels. Aluminum foil will work, as long as the entire project
is surrounded by the foil (except for the insulated wires providing power
and the output of the receiver). Sheet metal will also work, and will be less
likely to leak, since it is less likely to tear apart during transport.
Top of pagePrevious messageNext messageBottom of page Link to this message

high school modder (Unregistered Guest)
Unregistered guest
Posted From: 122.106.173.27
Posted on Tuesday, February 10, 2009 - 3:47 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Does anyone know where there is a basic small turbine blueprint? Its for an electronics major work for my school certificate (final Australian test before you leave school) but i cant find one anywhere. It should be powered by motion (hydroelectrical) which would power an amp i also plan to make. Magnets i have but super magnets is not an choice. It would need to produce 9 volts hopefully. Anyone ideas?
Top of pagePrevious messageNext messageBottom of page Link to this message

george harris (Rcking)
New member
Username: Rcking

Post Number: 1
Registered: 3-2009
Posted on Wednesday, March 11, 2009 - 3:08 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

hey I am looking into buying a nitro RC car and I was wondering if anybody knew of any webstites or brands that would have cars that are reliable?

Thanks
Top of pagePrevious messageNext messageBottom of page Link to this message

Jennifer (Unregistered Guest)
Unregistered guest
Posted From: 72.69.143.171
Posted on Sunday, March 15, 2009 - 6:40 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

How can I make a model of a hydroelectric plant?
Top of pagePrevious messageNext messageBottom of page Link to this message

Kayla S. (Unregistered Guest)
Unregistered guest
Posted From: 72.69.143.171
Posted on Sunday, March 15, 2009 - 6:43 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

How can I make a model of a hydroelectric plant?
Top of pagePrevious messageNext messageBottom of page Link to this message

JimS (Jimmy101)
Junior Member
Username: Jimmy101

Post Number: 5
Registered: 2-2007
Posted on Monday, March 16, 2009 - 3:47 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Kayla S. asked;
How can I make a model of a hydroelectric plant?


Do you want to build a working model?

The tricky part is coming up with the water turbine. Basically, the turbine is a propeller blade inside a housing. As the water goes through the housing it forces the blade to turn. A generator is attached to the blade's axle to generate electricity.

Coming up with a suitable housing and blade, then figuring out how to seal the axle's hole where it exits the housing will be the hard part.

On possibility would be to try using a "drill pump" as the housing / propeller / axle setup. Perhaps one of these;
http://www.northerntool.com/webapp/wcs/stores/servlet/ProductDisplay?storeId=6970&productId=11948&R=11948&cm_ven=TL&cm_cat=ERK&cm_pla=Google&cm_ite=pump
http://www.idealtruevalue.com/servlet/the-55405/Detail
Your local hardware store might carry something similar.

Use an elevated bucket of water as your "lake". Connect the "lake" to the turbine (the drill pump) with a length of garden hose.

Connect the axle of the "drill pump" to a small electric motor (perhaps a Scitoys homemade motor). Connect the wires from the electric motor to a volt meter or, if you get enough power out of the setup, to a small light bulb.

The higher your "lake" is above the turbine the more power the turbine will generate.


A tricky part will be coming up with a way to connect the axle of the drill pump to the axle of the motor. Perhaps use a short length of rubber tubing?
Top of pagePrevious messageNext messageBottom of page Link to this message

J N (Newty)
New member
Username: Newty

Post Number: 3
Registered: 5-2009
Posted on Monday, May 11, 2009 - 1:50 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Kayla S. asked;
How can I make a model of a hydroelectric plant?
--------------

Here are some step-by-step directions and other resources that might be helpful for building a tiny hydroelectric generator.

http://www.instructables.com/id/Home-made-Hydro-Power-System/
http://www.instructables.com/id/How_To_Make_A_Tesla_Turbine_Greenest_Turbine/

http://www.picohydro.org.uk/
http://en.wikipedia.org/wiki/Microgeneration
Top of pagePrevious messageNext messageBottom of page Link to this message

jacquie scott (Scott1164)
New member
Username: Scott1164

Post Number: 1
Registered: 6-2009
Posted on Wednesday, June 3, 2009 - 9:01 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Lecithin is an antioxidant that makes a good creamy emulsion. However, when lecithin is used to stabilize fats it goes rancid. what kind of preservative can I use to keep it from going rancid?
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1930
Registered: 12-2004
Posted on Wednesday, June 3, 2009 - 10:21 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Start by not letting any oxygen get to the fat to begin with.
Canning prevents air from getting to the fat.

Vitamins C and E are also good antioxidants.
Top of pagePrevious messageNext messageBottom of page Link to this message

Aye Hsu Mon Aung (Unregistered Guest)
Unregistered guest
Posted From: 220.255.7.203
Posted on Saturday, July 25, 2009 - 11:45 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Dear Sir/Madam,
I am doing science project about tha-na-khar ( Limonia Acidissima ) from Rutaceae family. It is a tree from Myanmar. Elders believe that tha-na-khar has anti-bacteria properties and I am testing on that. Luvangetin is one of the chemical constituents in this. My question is DOES LUVANGETIN HAVE ANTI-BACTERIA PROPERTIES? and may I know the function of Luvangetin and the properties of Luvangetin?

Your Sincerely
student who loves science
Top of pagePrevious messageNext messageBottom of page Link to this message

Simon Quellen Field (Sfield)
Senior Member
Username: Sfield

Post Number: 1933
Registered: 12-2004
Posted on Saturday, July 25, 2009 - 1:09 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

My friend Antony Williams runs a site called ChemSpider:
"http://www.chemspider.com/RecordView.aspx?rid=982054b6-14ca-4a6e-8998-98187e575f3d"

It is always a good place to start.

My own site for that molecule:
"http://sci-toys.com/scichem/jqp019/343582.html"

The molecule is biologically active, and is being studied to see if
it has effects on mammals:
"http://www.nextbio.com/b/search/ov/C09273?id=2908901&type=compound&synonym=C09273"
"http://www.novoseek.com/SearchAction.action?newSearch=1&query=%22Luvangetin%22[id%3Abioentity%3Achm_20042_none_1]&corpus=MEDLINE"
"http://toxnet.nlm.nih.gov/cgi-bin/sis/search/f?./temp/~FF9Gye:1"
"http://pubchem.ncbi.nlm.nih.gov/assay/assay.cgi?aid=330"

And on insects: "http://toxnet.nlm.nih.gov/cgi-bin/sis/search/f?./temp/~FF9Gye:2"


Other sources:
"http://cdb.ics.uci.edu/cgibin/ChemicalDetailWeb.psp?chemical_id=5246173"

The molecule is related to coumarin:
"http://en.wikipedia.org/wiki/Coumarin"
which plants produce because it is an appetite suppressant, and reduces
grazing. The anticoagulant warfarin is made from coumarin.

I see no studies relating this compound to antibiotic effects.
Yours may be the first. You may want to publish your results.
Top of pagePrevious messageNext messageBottom of page Link to this message

evan allen (Unregistered Guest)
Unregistered guest
Posted From: 174.57.170.23
Posted on Saturday, October 3, 2009 - 9:27 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

how do you make a copper boat thats small for a science project? and it has to float.
Top of pagePrevious messageNext messageBottom of page Link to this message

KIRAN (Muddy)
New member
Username: Muddy

Post Number: 1
Registered: 2-2010
Posted on Tuesday, February 16, 2010 - 10:20 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Hi.. i am doing a project that is given in SCIENCEBUDDIES..

http://www.sciencebuddies.org/science-fair-projects/project_ideas/Genom_p012.shtml?fave=no&isb=c2lkOjEsaWE6R2Vub20scDoyLHJpZDo1MjYwMzE5&from=TSW

It involves finding out evolutionary relationship between plants by CHLOROPLAST GENOME SEQUENCING.. Can you please tell me why only this particular sequence of primers are used for amplication of the RUBISCO part of the chloroplast genome???

Primer mix #1
Forward primer 5' ATGTCACCACAAACAGAAAC 3'
Reverse primer 5' CTTCACAAGCAGCTAGTTC 3'
Primer mix #2
Forward primer 5' ATGTCACCACAAACAGAAAC 3'
Reverse primer 5' TCCTTTTAGTAAAAGATTGGGCCGAG 3'

I have tried using PRIMER3 software to understand other kind of primers which could be obtained which amplifies Rubisco gene..
But why is only these primers used???
Will i get better amplification if i use different primer sequences???
Please answer as soon as possible..
Thank you..
Top of pagePrevious messageNext messageBottom of page Link to this message

KIRAN (Muddy)
New member
Username: Muddy

Post Number: 2
Registered: 2-2010
Posted on Tuesday, February 16, 2010 - 10:23 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Hi.. i am doing a project that is given in SCIENCEBUDDIES..

http://www.sciencebuddies.org/science-fair-projects/project_ideas/Genom_p012.shtml?fave=no&isb=c2lkOjEsaWE6R2Vub20scDoyLHJpZDo1MjYwMzE5&from=TSW

It involves finding out evolutionary relationship between plants by CHLOROPLAST GENOME SEQUENCING.. Can you please tell me why only this particular sequence of primers are used for amplication of the RUBISCO part of the chloroplast genome???

Primer mix #1
Forward primer 5' ATGTCACCACAAACAGAAAC 3'
Reverse primer 5' CTTCACAAGCAGCTAGTTC 3'
Primer mix #2
Forward primer 5' ATGTCACCACAAACAGAAAC 3'
Reverse primer 5' TCCTTTTAGTAAAAGATTGGGCCGAG 3'

I have tried using PRIMER3 software to understand other kind of primers which could be obtained which amplifies Rubisco gene..
But why is only these primers used???
Will i get better amplification if i use different primer sequences???
Please answer as soon as possible..
Thank you..
Top of pagePrevious messageNext messageBottom of page Link to this message

Jade Clifford (Unregistered Guest)
Unregistered guest
Posted From: 122.111.236.132
Posted on Tuesday, March 30, 2010 - 6:59 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Here's the assignment....please help me!

Working Scientifically: Problem Solving in Science

1. Design, construct and test a timing device, which sets off an alarm after 2
minutes, using readily available and inexpensive materials. Bring your device
to the workshop and be prepared to demonstrate its accuracy and ingenuity.
Top of pagePrevious messageNext messageBottom of page Link to this message

Lance (Unregistered Guest)
Unregistered guest
Posted From: 173.89.174.32
Posted on Monday, May 17, 2010 - 1:30 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

I am new to this type of thing so any help would be greatly appreciated. Using a dc motor which is installed horizontally, how can I get the motor to drive a rod vertically? Links to parts or pictures would be awesome. Thank you in advance.
Top of pagePrevious messageNext messageBottom of page Link to this message

Theresa Simmons (Theresa)
Senior Member
Username: Theresa

Post Number: 159
Registered: 1-2008
Posted on Monday, May 17, 2010 - 2:11 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Gears are the usual solution.
But look also at how bicycle speedometers work.
A cable rotates in a flexible tube, and the orientation of
the two ends can be anything you like.
Top of pagePrevious messageNext messageBottom of page Link to this message

Amanda Trefry (Atrefry000)
New member
Username: Atrefry000

Post Number: 1
Registered: 11-2010
Posted on Sunday, November 7, 2010 - 1:48 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

For my science fair project I have chosen to levitate a piece of ice between two magnets and pyrolytic graphite. I am having no luck levitating the ice. What am I doing wrong? Thank you!
Top of pagePrevious messageNext messageBottom of page Link to this message

Theresa Simmons (Theresa)
Senior Member
Username: Theresa

Post Number: 165
Registered: 1-2008
Posted on Monday, November 8, 2010 - 10:47 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

What made you think you could levitate ice?
Pyrolytic graphite will barely levitate all by itself, and it is the most
diamagnetic substance known. Ice is hardly diamagnetic at all. You would need
a Bitter solenoid to levitate ice, and that requires 6 megawatts of power
(enough to power 1,000 houses).
"http://en.wikipedia.org/wiki/Bitter_electromagnet"
"http://en.wikipedia.org/wiki/Magnetic_levitation"
"http://www.ru.nl/hfml/research/levitation/diamagnetic/bitter_solenoid/"
Top of pagePrevious messageNext messageBottom of page Link to this message

A FRIEND (Unregistered Guest)
Unregistered guest
Posted From: 24.8.190.18
Posted on Wednesday, November 10, 2010 - 1:13 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Levitating ice seems to be at the edge of what you might be able to do with materials you could reasonably obtain. There are two experiments you may try to emulate: the magnet in mid air and the floating pyrolytic graphite.

As for the magnet in mid air experiment, it works because the magnet has a large magnetization. Since ice is only weakly diagmagnetic, you might think that this would put the kibosh on the attempt, but you could try dissolving a strongly paramagnetic salt, like gadolinium sulfate, in water and then freezing the water to ice. The nice thing about gadolinium salts is that they are colorless and highly paramagnetic. The bad thing is that gadolinium is hard to come by and somewhat toxic. When they give you an MRI, they inject you with about a gram of gadolinium, but it is complexed to a polydentate ligand which serves to protect you from free Gd3+ ion and even so some people with near zero kidney function can be made sick because they can't eliminate the constrast reagent fast enough. So you would want to be careful with it if you tried this. But hey, they used to say making a spoon out of Wood's metal and having an unsuspecting victim stir his tea with it was a great practical joke, before the flap about Hanna Montana charm bracelets being made of out cadmium :-) .

Now, two problems with Gd2(SO4)3 in H2O: one is that when you freeze it, the ice will have a lower concentration of Gd2(SO4)3 than the liquid (recall that this is how zone refining works) and the other is that the overall material you get, even if you didn't dilute it by freezing, would be very weakly paramagnetic, and you don't see a whole lot of videos out there on the web where someone if levitating something even strongly paramagnetic (like terbium or warm gadolinium) or even something ferromagnetic (like a piece of steel or a Mond process ball) or even a weaker magnet than a neodymium-iron-boron one.

So if you wanted to go this route you may first want to try lifting weaker magnets than the N52 magnets sold on this website. Samarium-cobalt is the next step down, and you can get small samarium cobalt magnets lots of places. Then alnico: a chip off of a cheap horseshoe magnet would do. Or a small ferrite magnet which you can get at Home Depot.

To lift something like a piece of steel, which is ferromagnetic but not itself a permanent magnet is another large step up in difficulty. You might be able to do it with a setup that had a large (maybe 1 inch in size, but not bigger -- the ratio or danger to fun gets high after this) neodymium magnet on top and a superconducting YBCO disk underneath. The trouble with this is that although the magnet and the YBCO disk aren't too expensive, you have to keep supplying liquid nitrogen to keep the YBCO superconducting, so it costs something (call your local welding supply company to find out how much) every time you want to do the experiment.

To lift something which is merely paramagnetic and not ferromagnetic is another step up in difficulty again, I don't know whether the arrangement of the previous paragraph could do it. But even to lift up something with magnet+YBCO that wasn't itself a neodymium magnet would be a feat beyond what students ordinarily achieve in these kinds of projects.

The other possibility is like the floating pyrolytic graphite. Again you have the disadvantage that water is not as strongly diamagnetic as graphite, and also if you insist on working with ice, it means you have the additional constraint of keeping the whole apparatus cold while it is operational. Bismuth should be slighty easier to float than water or ice because its ratio of magnetic susceptibility to density is a little larger. Also you could try the experiment at room temperature in this case. I can envision geometries where you might be able to float a really small flake of bismuth, but not with the magnets that Simon sells. The best you could end up with would be possibly a flake of bismuth that is so small as to be hard to see floating so close to a magnet that it is hard to detect the separation. You might even be able to do ice or a drop of water like this but the result would be even less impressive. The first stable levitation was obtained with bismuth and a powerful (but not million-dollar kind of powerful) electromagnet, if I recall correctly.
Top of pagePrevious messageNext messageBottom of page Link to this message

swami238 (Unregistered Guest)
Unregistered guest
Posted From: 122.169.0.37
Posted on Tuesday, November 23, 2010 - 2:40 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

HI
I am a reseatch student. For one of my project I have developed a compound called " 2-(4-Aminophenyl)-5-aminobenzimidazole CAS No. 7621-86-5.

I am not able to proceed with my project as I could analyse the product for its purity and impurity profile.

Could any one from the science community could help me by giving information on how to test the product in HPLC or GC.
Top of pagePrevious messageNext messageBottom of page Link to this message

A FIREND (Unregistered Guest)
Unregistered guest
Posted From: 24.8.190.18
Posted on Friday, December 10, 2010 - 11:28 pm:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

I wanted to post this to the thread "Trouble with pyrolytic graphite" in the Forum "I am having trouble building one of the toys", but the forum software wouldn't let me so after taking the trouble to compose this long message I am posting it here.

This is an interesting old thread which contains inaccuracies that have persisted for years, so I just can't resist the opportunity to clear them up.

In his post of 4/30/03, Simon Quellen Field said:
"The magnetic field is strongest at the centers of the poles."
Actually this isn't true. For a rectangular magnet, the field is strongest at the edges. See http://www.youtube.com/watch?v=tR_8f0DYK5s from about 1:00 to 1:30 for a measurement with a gaussmeter.

SQF 5/10/03:
"I think you will find that the pyrolytic graphite is
not only much easier to work with, but will levitate
about three times higher."
(In comparison to randomly oriented graphite.)
This is wrong for a couple of reasons: Three times the force doesn't mean three times higher because the magnetic force doesn't vary linearly with height but instead drops off much more rapidly.
Also, what makes you think that the orientation of pg is more favorable than random orientation for this experiment? Of course, it's hard to compare directly becaue random graphite can have impurities that make it much less diamagnetic, or even paramagnetic as has been noted in this discussion. There is a way to test this assumption, though...

SQF 6/26/05:
"Magnetic repulsion falls off with
the third power of distance. Diamagnetic repulsion falls off with the
fourth power of distance."
At large distances between magnets, magnetic force falls off with the fourth power of distance. At closer separation, the relationship between force and distance is more complicated than a power law except for mathematically simple geometries such as spherical magnets.
Diamagnetic repulsion falls off as the fourth power of distance only for the case where you have a large thick diamagnet. This happens because the magnet sees a weak reflection of itself and repels as the fourth power of distance. If the diamagnet is thin, like the pg you can reasonably buy, the repulsion goes as the fifth power of distance because the reflection the magnet sees from the back side almost cancels out the reflection from the front. If the diamagnet is small, the repulsion goes as the seventh power of distance, just like a dipole-induced dipole force.

SQF 5/29/07:
"As magnets get farther away from one another, the field does begin to
look like a sphere. Now we get another effect happening, that will
show you why we get the fourth power.

You can think of a diamagnet as a mirror for a magnet. The magnet acts
as if it is seeing its mirror image in the diamagnet. Now you can see
that as you double the distance between the magnet and the mirror, you
quadruple the distance between the magnet and its mirror image. So instead
of a square law, we get a square law times a square law, hence the fourth
power."
The far field of a dipole still looks like the near field of an ideal dipole. To have a magnetic field that looks like a sphere a large distances, you would need a magnetic monopole. Of course, these can be purchased from the same vendors that sell fine bridges :-)
The fallacy in the second paragraph above can be best analyzed thus: If force varies with r2, then we can say that F = k•r2. Then if the distance to the image changes twice as fast as our distance to the mirror, we can say the r = 2•d, so F = k•(d/2)2 = (k/4)•d2, and still varies with d2.

Diego Assencio 10/23/08 said:
"what is the value of M inside the magnet?"
The definition of Br is that Br = m0•M.

ameya chandekar 12/6/10 said:
"CAN WE INCREASED THE LEVITATION HEIGHT OF THE PLATE BY INCREASING THE MAGNETIC INTENSITY OF THE MAGNET"
You may not be able to buy magnets stronger than N53, but you can at least in principle change some of the geometric factors in your favor. As the magnets grow bigger, the magnetic field that lifts the pg also gets bigger, so buying bigger magnets could help you lift higher. However, big neodymium magnets are really dangerous. Examples of the potential for injury and actual injury can be found on YouTube, just search for "neodymium fingers" -- you have to be ³ 18 to view.
Also, if the manufacturer were kind enough to leave the edges of the cubes as sharp as possible rather than rounding them off as they do, some of the most important material for lifting woudln't be destroyed, although it would make the magnets more fragile.
Top of pagePrevious messageNext messageBottom of page Link to this message

A FRIEND (Unregistered Guest)
Unregistered guest
Posted From: 24.8.190.18
Posted on Saturday, December 11, 2010 - 10:30 am:   Edit PostDelete PostView Post/Check IPPrint Post   Move Post (Moderator/Admin Only)Ban Poster IP (Moderator/Admin only)

Amazing that I couldn't even spell my own name in the above post. There are even more inaccuracies. In particular, for some reason I find myself saying "varies with" when I should be saying "varies inversely with" throughout the post. I offer the following corrections:

In my response to SQF's post of 5/10/03, I said:
"This is wrong for a couple of reasons: Three times the force doesn't mean three times higher because the magnetic force doesn't vary linearly with height but instead drops off much more rapidly."
I should have said:
"This is wrong for a couple of reasons: Three times the force doesn't mean three times higher because the magnetic force doesn't vary inversely with height but instead drops off much more rapidly."

In my response to SQF 6/26/05, I said:
"This happens because the magnet sees a weak reflection of itself and repels as the fourth power of distance. If the diamagnet is thin, like the pg you can reasonably buy, the repulsion goes as the fifth power of distance because the reflection the magnet sees from the back side almost cancels out the reflection from the front. If the diamagnet is small, the repulsion goes as the seventh power of distance, just like a dipole-induced dipole force."
I should have said:
"This happens because the magnet sees a weak reflection of itself and repels inversely as the fourth power of distance. If the diamagnet is thin, like the pg you can reasonably buy, the repulsion goes inversely as the fifth power of distance because the reflection the magnet sees from the back side almost cancels out the reflection from the front. If the diamagnet is small, the repulsion goes inversely as the seventh power of distance, just like a dipole-induced dipole force.

In my response to SQF 5/29/07 I said:
"The fallacy in the second paragraph above can be best analyzed thus: If force varies with r2, then we can say that F = k•r2. Then if the distance to the image changes twice as fast as our distance to the mirror, we can say the r = 2•d, so F = k•(d/2)2 = (k/4)•d2, and still varies with d2."
I should have said:
"The fallacy in the second paragraph above can be best analyzed thus: If force varies inversely with r2, then we can say that F = k/r2. Then if the distance to the image changes twice as fast as our distance to the mirror, we can say the r = 2•d, so F = k/(d/2)2 = (4k)/d2, and still varies inversely with d2."

Add Your Message Here
Post:
Username: Posting Information:
This is a public posting area. Enter your username and password if you have an account. Otherwise, enter your full name as your username and leave the password blank. Your e-mail address is optional.
Password:
E-mail:
Options: Enable HTML code in message
Automatically activate URLs in message
Action:
For those who have trouble spelling, the Google Toolbar (included in the Google Pack) can check and correct the spelling in your posts on this message board and others.

Renewable Energy

Topics | Last Day | Last Week | Tree View | Search | Help/Instructions | Program Credits Administration